VCV000540281.29 - ClinVar

NM_004960.4(FUS):c.518_523del

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(9)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Benign

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_004960.4(FUS):c.518_523del

Variation ID: 540281 Accession: VCV000540281.29

Type and length

Microsatellite, 6 bp

Location

Cytogenetic: 16p11.2 16: 31184372-31184377 (GRCh38) [ NCBI UCSC ] 16: 31195715-31195720 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	May 28, 2018	Oct 20, 2024	Apr 1, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_004960.4:c.518_523del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		splice donor
NM_004960.3:c.521_523+3del6
NM_004960.3:c.521_523+3delGAGGTG
NC_000016.10:g.31184376GAGGTG[3]
NC_000016.9:g.31195697GAGGTG[3]
NG_012889.2:g.9245GAGGTG[3]
LRG_655:g.9245GAGGTG[3]
LRG_655t1:c.521_523+3del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000016.10:31184371:GGTGGAGGTGGAGGTGGAGGTGGAGGTG:GGTGGAGGTGGAGGTGGAGGTG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA8023634 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
FUS		-	-	GRCh38 GRCh37	537	556

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Amyotrophic lateral sclerosis type 6 Tremor, hereditary essential, 4	Benign (2)	criteria provided, multiple submitters, no conflicts	Jan 31, 2024	RCV000650270.14
Amyotrophic lateral sclerosis type 6	Benign (1)	criteria provided, single submitter	May 28, 2019	RCV000989597.3
not provided	Benign (4)	criteria provided, multiple submitters, no conflicts	Apr 1, 2024	RCV001579952.16
not specified	Benign (1)	no assertion criteria provided	-	RCV001702827.3
FUS-related disorder	Likely benign (1)	no assertion criteria provided	Apr 26, 2019	RCV003918061.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Benign (May 28, 2019)	criteria provided, single submitter (Mendelics Assertion Criteria 2017) Method: clinical testing	Amyotrophic lateral sclerosis type 6 Affected status: unknown Allele origin: unknown	Mendelics Accession: SCV001140095.1 First in ClinVar: Jan 09, 2020 Last updated: Jan 09, 2020
Benign (Sep 22, 2020)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001892266.1 First in ClinVar: Sep 19, 2021 Last updated: Sep 19, 2021	Comment: This variant is associated with the following publications: (PMID: 19251627, 20668259, 20124201, 20544928)
Benign (Sep 03, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Amyotrophic lateral sclerosis type 6 Tremor, hereditary essential, 4 Affected status: unknown Allele origin: unknown	Fulgent Genetics, Fulgent Genetics Accession: SCV002805980.1 First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022
Benign (Jan 31, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Tremor, hereditary essential, 4 Amyotrophic lateral sclerosis type 6 Explanation for multiple conditions: Uncertain. The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000772110.7 First in ClinVar: May 28, 2018 Last updated: Feb 28, 2024
Benign (Apr 01, 2024)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV004139226.10 First in ClinVar: Nov 20, 2023 Last updated: Oct 20, 2024	Comment: FUS: BS1, BS2 Number of individuals with the variant: 4
Likely benign (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: germline	Genome Diagnostics Laboratory, Amsterdam University Medical Center Study: VKGL Data-share Consensus Accession: SCV001809153.1 First in ClinVar: Aug 26, 2021 Last updated: Aug 26, 2021
Benign (-)	no assertion criteria provided Method: clinical testing	not specified Affected status: yes Allele origin: germline	Genome Diagnostics Laboratory, University Medical Center Utrecht Additional submitter: Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen Study: VKGL Data-share Consensus Accession: SCV001932600.1 First in ClinVar: Sep 25, 2021 Last updated: Sep 25, 2021
Likely benign (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: germline	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center Additional submitter: Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen Study: VKGL Data-share Consensus Accession: SCV002038228.1 First in ClinVar: Dec 25, 2021 Last updated: Dec 25, 2021
Likely benign (Apr 26, 2019)	no assertion criteria provided Method: clinical testing	FUS-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV004734402.2 First in ClinVar: Mar 16, 2024 Last updated: Oct 08, 2024	Comment: This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_004960.4(FUS):c.518_523del

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...