In-frame deletion of 3 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; Occurs in the triple helical domain and is predicted to remove canonical Gly-X-Y repeat units; an in-frame deletion variant in this region is expected to disrupt normal protein folding and function, and this is an established mechanism of disease (Stenson et al., 2014); This variant is associated with the following publications: (PMID: 1939261, 22795119, 28261977, 34025714, 21239989, 32627857)
ClinVar Genomic variation as it relates to human health
NM_000088.4(COL1A1):c.3141TCCTGGTGC[1] (p.1047APG[2])
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(10)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
10
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000088.4(COL1A1):c.3141TCCTGGTGC[1] (p.1047APG[2])
Variation ID: 372753 Accession: VCV000372753.16
- Type and length
-
Microsatellite, 9 bp
- Location
-
Cytogenetic: 17q21.33 17: 50188579-50188587 (GRCh38) [ NCBI UCSC ] 17: 48265940-48265948 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jan 9, 2017 Sep 1, 2024 Dec 22, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000088.4:c.3141TCCTGGTGC[1] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000079.2:p.1047APG[2] inframe deletion NM_000088.4:c.3150_3158del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_000088.3:c.3150_3158delTCCTGGTGC NC_000017.11:g.50188587AGCACCAGG[1] NC_000017.10:g.48265948AGCACCAGG[1] NG_007400.1:g.18044TCCTGGTGC[1] LRG_1:g.18044TCCTGGTGC[1] LRG_1t1:c.3150_3158del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000017.11:50188578:GCACCAGGAGCACCAGGAGCACCAGG:GCACCAGGAGCACCAGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| COL1A1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
2758 | 2962 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
no assertion criteria provided
|
Dec 10, 2020 | RCV001270301.1 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jun 1, 2020 | RCV002278641.3 | |
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Dec 22, 2022 | RCV000413092.6 | |
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Nov 9, 2017 | RCV000623236.5 | |
| Pathogenic (2) |
criteria provided, single submitter
|
Nov 22, 2022 | RCV002524640.4 | |
|
COL1A1-related disorder
|
Pathogenic (1) |
criteria provided, single submitter
|
Dec 22, 2022 | RCV004549835.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Jun 29, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Athena Diagnostics
Accession: SCV000841073.1
First in ClinVar: Oct 20, 2018 Last updated: Oct 20, 2018 |
|
|
|
Pathogenic
(Jun 01, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Osteogenesis imperfecta
Affected status: unknown
Allele origin:
germline
|
Genome Diagnostics Laboratory, The Hospital for Sick Children
Accession: SCV002564720.1
First in ClinVar: Aug 29, 2022 Last updated: Aug 29, 2022 |
|
|
|
Pathogenic
(Nov 09, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Osteogenesis imperfecta, perinatal lethal
Affected status: yes
Allele origin:
unknown
|
Center For Human Genetics And Laboratory Diagnostics, Dr. Klein, Dr. Rost And Colleagues
Accession: SCV000740281.2
First in ClinVar: Apr 15, 2018 Last updated: Dec 11, 2022 |
|
|
|
Pathogenic
(Dec 22, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000491211.3
First in ClinVar: Jan 09, 2017 Last updated: Dec 31, 2022 |
Comment:
In-frame deletion of 3 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts … (more)
In-frame deletion of 3 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; Occurs in the triple helical domain and is predicted to remove canonical Gly-X-Y repeat units; an in-frame deletion variant in this region is expected to disrupt normal protein folding and function, and this is an established mechanism of disease (Stenson et al., 2014); This variant is associated with the following publications: (PMID: 1939261, 22795119, 28261977, 34025714, 21239989, 32627857) (less)
|
|
|
Pathogenic
(Dec 22, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
COL1A1-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004107961.1
First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023 |
Comment:
The COL1A1 c.3150_3158del9 variant is predicted to result in an in-frame deletion (p.Ala1053_Gly1055del). This variant was reported to have occurred de novo in multiple cases … (more)
The COL1A1 c.3150_3158del9 variant is predicted to result in an in-frame deletion (p.Ala1053_Gly1055del). This variant was reported to have occurred de novo in multiple cases of lethal type osteogenesis imperfecta (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Chen et al. 2012. PubMed ID: 22795119; Corsten-Janssen et al. 2020. PubMed ID: 32627857). In the mosaic state, this variant was documented in a milder manifestation (Symoens et al. 2017. PubMed ID: 28261977). Functional studies showed that this variant results in overmodification of the mutant type I collagen (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Symoens et al. 2017. PubMed ID: 28261977). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic. (less)
|
|
|
Pathogenic
(Nov 22, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Osteogenesis imperfecta type I
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003442402.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant disrupts the triple helix domain of COL1A1. Glycine residues within the Gly-Xaa-Yaa repeats … (more)
For these reasons, this variant has been classified as Pathogenic. This variant disrupts the triple helix domain of COL1A1. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL1A1, variants affecting these glycine residues are significantly enriched in individuals with disease (PMID: 9016532, 17078022) compared to the general population (ExAC). ClinVar contains an entry for this variant (Variation ID: 372753). This variant is also known as deletion of 9 base pairs, 868-876, single Gly-Ala-Pro triplet. This variant has been observed in individual(s) with clinical features of Ehlers-Danlos syndrome and/or osteogenesis imperfecta (PMID: 1939261, 28261977). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.3150_3158del, results in the deletion of 3 amino acid(s) of the COL1A1 protein (p.Ala1053_Gly1055del), but otherwise preserves the integrity of the reading frame. (less)
|
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Osteogenesis imperfecta, perinatal lethal
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
de novo
|
Kasturba Medical College, Manipal, Kasturba Medical College, Manipal, Manipal Academy of Higher Education, Manipal, India
Accession: SCV005077928.1
First in ClinVar: Sep 01, 2024 Last updated: Sep 01, 2024 |
|
|
|
Pathogenic
(Dec 10, 2020)
|
no assertion criteria provided
Method: literature only
|
OSTEOGENESIS IMPERFECTA, TYPE II
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV001450508.1
First in ClinVar: Dec 19, 2020 Last updated: Dec 19, 2020 |
Comment on evidence:
Osteogenesis Imperfecta, Type II In an infant with lethal osteogenesis imperfecta type II (OI2; 166210), Hawkins et al. (1991) identified a 9-bp deletion in the … (more)
Osteogenesis Imperfecta, Type II In an infant with lethal osteogenesis imperfecta type II (OI2; 166210), Hawkins et al. (1991) identified a 9-bp deletion in the COL1A1 gene, which was not present in the parents. The mutation was said to occur within a repeating sequence of exon 43, causing the loss of 1 of 3 consecutive gly-ala-pro triplets at positions 868-876, but does not disrupt the Gly-X-Y sequence. Combined Osteogenesis Imperfecta and Ehlers-Danlos Syndrome 1 In a patient with combined osteogenesis imperfecta and Ehlers-Danlos syndrome-1 (OIEDS1; 619115), Symoens et al. (2017) identified a heterozygous in-frame 9-bp deletion (c.3150_3158del) in exon 44 of the COL1A1 gene, resulting in deletion of 3 amino acids (Ala1053_Gly1055del). This mutation was seen in 9% of DNA derived from patient fibroblasts and in none of the DNA derived from blood. Symoens et al. (2017) stated that this was the same mutation identified by Hawkins et al. (1991) in a patient with lethal OI and concluded that mosaicism might have been responsible for the mild symptoms in their patient. (less)
|
|
|
Pathogenic
(Dec 10, 2020)
|
no assertion criteria provided
Method: literature only
|
COMBINED OSTEOGENESIS IMPERFECTA AND EHLERS-DANLOS SYNDROME 1
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV001450509.1
First in ClinVar: Dec 19, 2020 Last updated: Dec 19, 2020 |
Comment on evidence:
Osteogenesis Imperfecta, Type II In an infant with lethal osteogenesis imperfecta type II (OI2; 166210), Hawkins et al. (1991) identified a 9-bp deletion in the … (more)
Osteogenesis Imperfecta, Type II In an infant with lethal osteogenesis imperfecta type II (OI2; 166210), Hawkins et al. (1991) identified a 9-bp deletion in the COL1A1 gene, which was not present in the parents. The mutation was said to occur within a repeating sequence of exon 43, causing the loss of 1 of 3 consecutive gly-ala-pro triplets at positions 868-876, but does not disrupt the Gly-X-Y sequence. Combined Osteogenesis Imperfecta and Ehlers-Danlos Syndrome 1 In a patient with combined osteogenesis imperfecta and Ehlers-Danlos syndrome-1 (OIEDS1; 619115), Symoens et al. (2017) identified a heterozygous in-frame 9-bp deletion (c.3150_3158del) in exon 44 of the COL1A1 gene, resulting in deletion of 3 amino acids (Ala1053_Gly1055del). This mutation was seen in 9% of DNA derived from patient fibroblasts and in none of the DNA derived from blood. Symoens et al. (2017) stated that this was the same mutation identified by Hawkins et al. (1991) in a patient with lethal OI and concluded that mosaicism might have been responsible for the mild symptoms in their patient. (less)
|
|
|
Pathogenic
(Oct 09, 2023)
|
no assertion criteria provided
Method: clinical testing
|
Osteogenesis imperfecta type I
Affected status: yes
Allele origin:
germline
|
Zotz-Klimas Genetics Lab, MVZ Zotz Klimas
Accession: SCV004041744.1
First in ClinVar: Oct 14, 2023 Last updated: Oct 14, 2023 |
|
Comment:
Comment:
The COL1A1 c.3150_3158del9 variant is predicted to result in an in-frame deletion (p.Ala1053_Gly1055del). This variant was reported to have occurred de novo in multiple cases of lethal type osteogenesis imperfecta (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Chen et al. 2012. PubMed ID: 22795119; Corsten-Janssen et al. 2020. PubMed ID: 32627857). In the mosaic state, this variant was documented in a milder manifestation (Symoens et al. 2017. PubMed ID: 28261977). Functional studies showed that this variant results in overmodification of the mutant type I collagen (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Symoens et al. 2017. PubMed ID: 28261977). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic.
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant disrupts the triple helix domain of COL1A1. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL1A1, variants affecting these glycine residues are significantly enriched in individuals with disease (PMID: 9016532, 17078022) compared to the general population (ExAC). ClinVar contains an entry for this variant (Variation ID: 372753). This variant is also known as deletion of 9 base pairs, 868-876, single Gly-Ala-Pro triplet. This variant has been observed in individual(s) with clinical features of Ehlers-Danlos syndrome and/or osteogenesis imperfecta (PMID: 1939261, 28261977). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.3150_3158del, results in the deletion of 3 amino acid(s) of the COL1A1 protein (p.Ala1053_Gly1055del), but otherwise preserves the integrity of the reading frame.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
In-frame deletion of 3 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; Occurs in the triple helical domain and is predicted to remove canonical Gly-X-Y repeat units; an in-frame deletion variant in this region is expected to disrupt normal protein folding and function, and this is an established mechanism of disease (Stenson et al., 2014); This variant is associated with the following publications: (PMID: 1939261, 22795119, 28261977, 34025714, 21239989, 32627857)
Comment:
The COL1A1 c.3150_3158del9 variant is predicted to result in an in-frame deletion (p.Ala1053_Gly1055del). This variant was reported to have occurred de novo in multiple cases of lethal type osteogenesis imperfecta (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Chen et al. 2012. PubMed ID: 22795119; Corsten-Janssen et al. 2020. PubMed ID: 32627857). In the mosaic state, this variant was documented in a milder manifestation (Symoens et al. 2017. PubMed ID: 28261977). Functional studies showed that this variant results in overmodification of the mutant type I collagen (Hawkins and Steinmann. 1991. PubMed ID: 1939261; Symoens et al. 2017. PubMed ID: 28261977). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic.
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant disrupts the triple helix domain of COL1A1. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL1A1, variants affecting these glycine residues are significantly enriched in individuals with disease (PMID: 9016532, 17078022) compared to the general population (ExAC). ClinVar contains an entry for this variant (Variation ID: 372753). This variant is also known as deletion of 9 base pairs, 868-876, single Gly-Ala-Pro triplet. This variant has been observed in individual(s) with clinical features of Ehlers-Danlos syndrome and/or osteogenesis imperfecta (PMID: 1939261, 28261977). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.3150_3158del, results in the deletion of 3 amino acid(s) of the COL1A1 protein (p.Ala1053_Gly1055del), but otherwise preserves the integrity of the reading frame.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Tissue-specific mosaicism for a lethal osteogenesis imperfecta COL1A1 mutation causes mild OI/EDS overlap syndrome. | Symoens S | American journal of medical genetics. Part A | 2017 | PMID: 28261977 |
| Identification of a deletion mutation in the short flanking repeat region of exon 44 of the COL1A1 gene in a fetus with osteogenesis imperfecta type II. | Chen CP | Taiwanese journal of obstetrics & gynecology | 2012 | PMID: 22795119 |
| Collagen structure and stability. | Shoulders MD | Annual review of biochemistry | 2009 | PMID: 19344236 |
| Consortium for osteogenesis imperfecta mutations in the helical domain of type I collagen: regions rich in lethal mutations align with collagen binding sites for integrins and proteoglycans. | Marini JC | Human mutation | 2007 | PMID: 17078022 |
| The human type I collagen mutation database. | Dalgleish R | Nucleic acids research | 1997 | PMID: 9016532 |
| Crystal and molecular structure of a collagen-like peptide at 1.9 A resolution. | Bella J | Science (New York, N.Y.) | 1994 | PMID: 7695699 |
| Characterization of collagen-like peptides containing interruptions in the repeating Gly-X-Y sequence. | Long CG | Biochemistry | 1993 | PMID: 8218237 |
| A 9-base pair deletion in COL1A1 in a lethal variant of osteogenesis imperfecta. | Hawkins JR | The Journal of biological chemistry | 1991 | PMID: 1939261 |
Text-mined citations for rs74315111 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Nov 30, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.