The c.6202_6225del24 variant (also known as p.M2068_D2075del) is located in coding exon 15 of the APC gene. This variant results from an in-frame ATGGGTGGCATATTAGGTGAAGAT deletion at nucleotide positions 6202 to 6225. This results in the in-frame deletion of eight residues (MGGILGED) at codons 2068-2075. This amino acid region is well conserved in available vertebrate species. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear.
ClinVar Genomic variation as it relates to human health
NM_000038.6(APC):c.6202_6225del (p.Met2068_Asp2075del)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000038.6(APC):c.6202_6225del (p.Met2068_Asp2075del)
Variation ID: 3412019 Accession: VCV003412019.1
- Type and length
-
Deletion, 24 bp
- Location
-
5: 112841794-112841817 (GRCh38) [ NCBI UCSC ] 5: 112177491-112177514 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jan 13, 2025 Jan 13, 2025 Nov 13, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000038.6:c.6202_6225del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000029.2:p.Met2068_Asp2075del NM_001127510.3:c.6202_6225del NP_001120982.1:p.Met2068_Asp2075del NM_001127511.3:c.6148_6171del NP_001120983.2:p.Met2050_Asp2057del NM_001354895.2:c.6202_6225del NP_001341824.1:p.Met2068_Asp2075del NM_001354896.2:c.6256_6279del NP_001341825.1:p.Met2086_Asp2093del NM_001354897.2:c.6232_6255del NP_001341826.1:p.Met2078_Asp2085del NM_001354898.2:c.6127_6150del NP_001341827.1:p.Met2043_Asp2050del NM_001354899.2:c.6118_6141del NP_001341828.1:p.Met2040_Asp2047del NM_001354900.2:c.6079_6102del NP_001341829.1:p.Met2027_Asp2034del NM_001354901.2:c.6025_6048del NP_001341830.1:p.Met2009_Asp2016del NM_001354902.2:c.5929_5952del NP_001341831.1:p.Met1977_Asp1984del NM_001354903.2:c.5899_5922del NP_001341832.1:p.Met1967_Asp1974del NM_001354904.2:c.5824_5847del NP_001341833.1:p.Met1942_Asp1949del NM_001354905.2:c.5722_5745del NP_001341834.1:p.Met1908_Asp1915del NM_001354906.2:c.5353_5376del NP_001341835.1:p.Met1785_Asp1792del NM_001407446.1:c.6286_6309del NP_001394375.1:p.Met2096_Asp2103del NM_001407447.1:c.6256_6279del NP_001394376.1:p.Met2086_Asp2093del NM_001407448.1:c.6256_6279del NP_001394377.1:p.Met2086_Asp2093del NM_001407449.1:c.6256_6279del NP_001394378.1:p.Met2086_Asp2093del NM_001407450.1:c.6202_6225del NP_001394379.1:p.Met2068_Asp2075del NM_001407451.1:c.6181_6204del NP_001394380.1:p.Met2061_Asp2068del NM_001407452.1:c.6172_6195del NP_001394381.1:p.Met2058_Asp2065del NM_001407453.1:c.6025_6048del NP_001394382.1:p.Met2009_Asp2016del NM_001407454.1:c.5953_5976del NP_001394383.1:p.Met1985_Asp1992del NM_001407455.1:c.5953_5976del NP_001394384.1:p.Met1985_Asp1992del NM_001407456.1:c.5953_5976del NP_001394385.1:p.Met1985_Asp1992del NM_001407457.1:c.5953_5976del NP_001394386.1:p.Met1985_Asp1992del NM_001407458.1:c.5899_5922del NP_001394387.1:p.Met1967_Asp1974del NM_001407459.1:c.5899_5922del NP_001394388.1:p.Met1967_Asp1974del NM_001407460.1:c.5899_5922del NP_001394389.1:p.Met1967_Asp1974del NM_001407467.1:c.5815_5838del NP_001394396.1:p.Met1939_Asp1946del NM_001407469.1:c.5815_5838del NP_001394398.1:p.Met1939_Asp1946del NM_001407470.1:c.5353_5376del NP_001394399.1:p.Met1785_Asp1792del NM_001407471.1:c.5050_5073del NP_001394400.1:p.Met1684_Asp1691del NM_001407472.1:c.5050_5073del NP_001394401.1:p.Met1684_Asp1691del NR_176365.1:n.6037_6060del non-coding transcript variant NR_176366.1:n.6456_6479del non-coding transcript variant NC_000005.10:g.112841796_112841819del NC_000005.9:g.112177493_112177516del NG_008481.4:g.154276_154299del LRG_130:g.154276_154299del LRG_130t1:c.6202_6225del24 LRG_130p1:p.Met2068_Asp2075del LRG_130t2:c.6202_6225del24 LRG_130p2:p.Met2068_Asp2075del LRG_130t3:c.6202_6225del24 LRG_130p3:p.Met2068_Asp2075del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000005.10:112841793:ATATGGGTGGCATATTAGGTGAAGAT:AT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| APC | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
15241 | 15379 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
Nov 13, 2024 | RCV004945524.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(Nov 13, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV005467724.1
First in ClinVar: Jan 13, 2025 Last updated: Jan 13, 2025 |
Comment:
The c.6202_6225del24 variant (also known as p.M2068_D2075del) is located in coding exon 15 of the APC gene. This variant results from an in-frame ATGGGTGGCATATTAGGTGAAGAT deletion … (more)
The c.6202_6225del24 variant (also known as p.M2068_D2075del) is located in coding exon 15 of the APC gene. This variant results from an in-frame ATGGGTGGCATATTAGGTGAAGAT deletion at nucleotide positions 6202 to 6225. This results in the in-frame deletion of eight residues (MGGILGED) at codons 2068-2075. This amino acid region is well conserved in available vertebrate species. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
The c.6202_6225del24 variant (also known as p.M2068_D2075del) is located in coding exon 15 of the APC gene. This variant results from an in-frame ATGGGTGGCATATTAGGTGAAGAT deletion at nucleotide positions 6202 to 6225. This results in the in-frame deletion of eight residues (MGGILGED) at codons 2068-2075. This amino acid region is well conserved in available vertebrate species. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Jan 13, 2025
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.