ClinVar Genomic variation as it relates to human health
NM_001326342.2(CELF2):c.241_262dup (p.Gln88fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001326342.2(CELF2):c.241_262dup (p.Gln88fs)
Variation ID: 3375484 Accession: VCV003375484.1
- Type and length
-
Duplication, 22 bp
- Location
-
Cytogenetic: 10p14 10: 11165651-11165652 (GRCh38) [ NCBI UCSC ] 10: 11207614-11207615 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 19, 2024 Nov 17, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001326342.2:c.241_262dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001313271.1:p.Gln88fs frameshift NM_001025076.2:c.148_169dup NP_001020247.1:p.Gln57fs frameshift NM_001025077.3:c.220_241dup NP_001020248.1:p.Gln81fs frameshift NM_001083591.1:c.148_169dup NP_001077060.1:p.Gln57fs frameshift NM_001326317.2:c.148_169dup NP_001313246.1:p.Gln57fs frameshift NM_001326318.2:c.148_169dup NP_001313247.1:p.Gln57fs frameshift NM_001326319.2:c.148_169dup NP_001313248.1:p.Gln57fs frameshift NM_001326320.2:c.148_169dup NP_001313249.1:p.Gln57fs frameshift NM_001326321.2:c.148_169dup NP_001313250.1:p.Gln57fs frameshift NM_001326323.2:c.148_169dup NP_001313252.1:p.Gln57fs frameshift NM_001326324.2:c.148_169dup NP_001313253.1:p.Gln57fs frameshift NM_001326325.2:c.313_334dup NP_001313254.1:p.Gln112fs frameshift NM_001326326.2:c.256_277dup NP_001313255.1:p.Gln93fs frameshift NM_001326327.2:c.256_277dup NP_001313256.1:p.Gln93fs frameshift NM_001326328.2:c.148_169dup NP_001313257.1:p.Gln57fs frameshift NM_001326329.2:c.148_169dup NP_001313258.1:p.Gln57fs frameshift NM_001326330.2:c.148_169dup NP_001313259.1:p.Gln57fs frameshift NM_001326331.2:c.220_241dup NP_001313260.1:p.Gln81fs frameshift NM_001326332.2:c.220_241dup NP_001313261.1:p.Gln81fs frameshift NM_001326333.2:c.-385_-364dup 5 prime UTR NM_001326334.2:c.148_169dup NP_001313263.1:p.Gln57fs frameshift NM_001326335.2:c.220_241dup NP_001313264.1:p.Gln81fs frameshift NM_001326336.2:c.220_241dup NP_001313265.1:p.Gln81fs frameshift NM_001326337.2:c.220_241dup NP_001313266.1:p.Gln81fs frameshift NM_001326338.2:c.-31_-10dup 5 prime UTR NM_001326339.2:c.-31_-10dup 5 prime UTR NM_001326340.2:c.241_262dup NP_001313269.1:p.Gln88fs frameshift NM_001326341.2:c.241_262dup NP_001313270.1:p.Gln88fs frameshift NM_001326343.2:c.241_262dup NP_001313272.1:p.Gln88fs frameshift NM_001326344.2:c.148_169dup NP_001313273.1:p.Gln57fs frameshift NM_001326345.2:c.148_169dup NP_001313274.1:p.Gln57fs frameshift NM_001326346.2:c.-302_-281dup 5 prime UTR NM_001326347.1:c.172_193dup NP_001313276.1:p.Gln65fs frameshift NM_001326348.2:c.148_169dup NP_001313277.1:p.Gln57fs frameshift NM_001326349.2:c.148_169dup NP_001313278.1:p.Gln57fs frameshift NM_001394502.1:c.220_241dup NP_001381431.1:p.Gln81fs frameshift NM_001394513.1:c.241_262dup NP_001381442.1:p.Gln88fs frameshift NM_001394517.1:c.148_169dup NP_001381446.1:p.Gln57fs frameshift NM_001394518.1:c.241_262dup NP_001381447.1:p.Gln88fs frameshift NM_001394519.1:c.241_262dup NP_001381448.1:p.Gln88fs frameshift NM_006561.4:c.241_262dup NP_006552.3:p.Gln88fs frameshift NC_000010.11:g.11165652_11165673dup NC_000010.10:g.11207615_11207636dup NG_182741.1:g.41_62dup - Protein change
- Q112fs, Q57fs, Q65fs, Q81fs, Q88fs, Q93fs
- Other names
- -
- Canonical SPDI
- NC_000010.11:11165651:GACCGGAGTCAGAACCCTCCGC:GACCGGAGTCAGAACCCTCCGCGACCGGAGTCAGAACCCTCCGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| CELF2 | - | - |
GRCh38 GRCh37 |
39 | 89 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Likely pathogenic (1) |
criteria provided, single submitter
|
- | RCV004782232.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Likely pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Developmental and epileptic encephalopathy 97
Affected status: yes
Allele origin:
germline
|
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne
Accession: SCV005395952.1
First in ClinVar: Nov 17, 2024 Last updated: Nov 17, 2024 |
|
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Nov 19, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.