VCV003012688.1 - ClinVar

NM_000142.5(FGFR3):c.436_445+2dup

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Uncertain significance

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000142.5(FGFR3):c.436_445+2dup

Variation ID: 3012688 Accession: VCV003012688.1

Type and length

Duplication, 12 bp

Location

Cytogenetic: 4p16.3 4: 1799792-1799793 (GRCh38) [ NCBI UCSC ] 4: 1801519-1801520 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 29, 2024	Feb 28, 2024	Jun 26, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_000142.5:c.436_445+2dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		splice donor
NM_001163213.2:c.436_445+2dup		splice donor
NM_001354809.2:c.436_445+2dup		splice donor
NM_001354810.2:c.436_445+2dup		splice donor
NM_022965.4:c.436_445+2dup		splice donor
NC_000004.12:g.1799803_1799814dup
NC_000004.11:g.1801530_1801541dup
NG_012632.1:g.11492_11503dup
LRG_1021:g.11492_11503dup

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000004.12:1799792:GGACACAGGTGTGGACACAGGT:GGACACAGGTGTGGACACAGGTGTGGACACAGGT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
FGFR3		No evidence available	No evidence available	GRCh38 GRCh37	984	1134

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Uncertain significance (1)	criteria provided, single submitter	Jun 26, 2023	RCV003877799.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Jun 26, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004674646.1 First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024	Publications: PubMed (2) PubMed: 17576681‚ 9536098 Comment: In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more) In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with FGFR3-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change falls in intron 4 of the FGFR3 gene. It does not directly change the encoded amino acid sequence of the FGFR3 protein. It affects a nucleotide within the consensus splice site. (less)

Comment:

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with FGFR3-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change falls in intron 4 of the FGFR3 gene. It does not directly change the encoded amino acid sequence of the FGFR3 protein. It affects a nucleotide within the consensus splice site.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Aberrant 5' splice sites in human disease genes: mutation pattern, nucleotide structure and comparison of computational tools that predict their utilization.	Buratti E	Nucleic acids research	2007	PMID: 17576681
Statistical features of human exons and their flanking regions.	Zhang MQ	Human molecular genetics	1998	PMID: 9536098

Text-mined citations for this variant ...

Record last updated Sep 30, 2024

ClinVar Genomic variation as it relates to human health

NM_000142.5(FGFR3):c.436_445+2dup

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...