VCV002858042.1 - ClinVar

NM_025215.6(PUS1):c.112_128del (p.Ala38fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_025215.6(PUS1):c.112_128del (p.Ala38fs)

Variation ID: 2858042 Accession: VCV002858042.1

Type and length

Deletion, 17 bp

Location

Cytogenetic: 12q24.33 12: 131929940-131929956 (GRCh38) [ NCBI UCSC ] 12: 132414485-132414501 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 20, 2024	Feb 20, 2024	Apr 20, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_025215.6:c.112_128del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_079491.2:p.Ala38fs	frameshift
NM_001002019.3:c.28_44del	NP_001002019.1:p.Ala10fs	frameshift
NM_001002020.3:c.28_44del	NP_001002020.1:p.Ala10fs	frameshift
NC_000012.12:g.131929944_131929960del
NC_000012.11:g.132414489_132414505del
NG_013039.1:g.5745_5761del
NG_013039.2:g.5670_5686del
NG_188881.1:g.196_212del

... more HGVS ... less HGVS

Protein change

A10fs, A38fs

Other names

Canonical SPDI

NC_000012.12:131929939:GCCCGCCGGAGCCGCATGCCC:GCCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
LOC130009240	-	-	-	GRCh38	-	71
PUS1		-	-	GRCh38 GRCh37	476	619

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (1)	criteria provided, single submitter	Apr 20, 2023	RCV003704158.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Apr 20, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004460401.1 First in ClinVar: Feb 20, 2024 Last updated: Feb 20, 2024	Publications: PubMed (4) PubMed: 17056637‚ 19731322‚ 25058219‚ 26556812 Comment: This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. This variant has not … (more) This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with PUS1-related conditions. This sequence change creates a premature translational stop signal (p.Ala38Profs*70) in the PUS1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PUS1 are known to be pathogenic (PMID: 17056637, 19731322, 25058219, 26556812). (less)

Comment:

This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with PUS1-related conditions. This sequence change creates a premature translational stop signal (p.Ala38Profs*70) in the PUS1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PUS1 are known to be pathogenic (PMID: 17056637, 19731322, 25058219, 26556812).

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Clinical and molecular study in a long-surviving patient with MLASA syndrome due to novel PUS1 mutations.	Cao M	Neurogenetics	2016	PMID: 26556812
Use of whole-exome sequencing to determine the genetic basis of multiple mitochondrial respiratory chain complex deficiencies.	Taylor RW	JAMA	2014	PMID: 25058219
Systematic molecular genetic analysis of congenital sideroblastic anemia: evidence for genetic heterogeneity and identification of novel mutations.	Bergmann AK	Pediatric blood & cancer	2010	PMID: 19731322
Nonsense mutation in pseudouridylate synthase 1 (PUS1) in two brothers affected by myopathy, lactic acidosis and sideroblastic anaemia (MLASA).	Fernandez-Vizarra E	Journal of medical genetics	2007	PMID: 17056637

Text-mined citations for this variant ...

Record last updated Sep 30, 2024

ClinVar Genomic variation as it relates to human health

NM_025215.6(PUS1):c.112_128del (p.Ala38fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...