VCV002681129.4 - ClinVar

NM_000104.4(CYP1B1):c.346_363del (p.Asp116_Ala121del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(3)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000104.4(CYP1B1):c.346_363del (p.Asp116_Ala121del)

Variation ID: 2681129 Accession: VCV002681129.4

Type and length

Deletion, 18 bp

Location

Cytogenetic: 2p22.2 2: 38075026-38075043 (GRCh38) [ NCBI UCSC ] 2: 38302169-38302186 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 30, 2023	Sep 29, 2024	Jan 11, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_000104.4:c.346_363del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000095.2:p.Asp116_Ala121del
NM_000104.3:c.346_363del
NC_000002.12:g.38075037_38075054del
NC_000002.11:g.38302180_38302197del
NG_008386.2:g.6059_6076del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000002.12:38075025:GGCGAAGGCCGGCCGGTCGGCGAAGGCCG:GGCGAAGGCCG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
CYP1B1		-	-	GRCh38 GRCh37	463	549

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Anterior segment dysgenesis 6	Likely pathogenic (1)	criteria provided, single submitter	Jan 11, 2024	RCV003468664.2
Congenital glaucoma	Pathogenic (1)	criteria provided, single submitter	Dec 26, 2023	RCV003759881.2
not provided	Pathogenic (1)	criteria provided, single submitter	Sep 13, 2023	RCV004719335.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Jan 11, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Anterior segment dysgenesis 6 Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004215477.2 First in ClinVar: Dec 30, 2023 Last updated: Jun 17, 2024
Pathogenic (Dec 26, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Congenital glaucoma Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004446008.1 First in ClinVar: Feb 20, 2024 Last updated: Feb 20, 2024	Publications: PubMed (3) PubMed: 27820421‚ 17893647‚ 27243976 Comment: This variant, c.346_363del, results in the deletion of 6 amino acid(s) of the CYP1B1 protein (p.Asp116_Ala121del), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.346_363del, results in the deletion of 6 amino acid(s) of the CYP1B1 protein (p.Asp116_Ala121del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs753591839, gnomAD 0.003%). This variant has been observed in individual(s) with primary congenital glaucoma (PMID: 27820421). This variant disrupts a region of the CYP1B1 protein in which other variant(s) (p.Arg117Leu) have been determined to be pathogenic (PMID: 17893647, 27243976; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Sep 13, 2023)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV005325826.1 First in ClinVar: Sep 29, 2024 Last updated: Sep 29, 2024	Comment: In-frame deletion of six amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts … (more) In-frame deletion of six amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 27820421) (less)

Comment:

This variant, c.346_363del, results in the deletion of 6 amino acid(s) of the CYP1B1 protein (p.Asp116_Ala121del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs753591839, gnomAD 0.003%). This variant has been observed in individual(s) with primary congenital glaucoma (PMID: 27820421). This variant disrupts a region of the CYP1B1 protein in which other variant(s) (p.Arg117Leu) have been determined to be pathogenic (PMID: 17893647, 27243976; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.

Comment:

In-frame deletion of six amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 27820421)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
CYP1B1 Mutations in Individuals With Primary Congenital Glaucoma and Residing in Denmark.	Grønskov K	Journal of glaucoma	2016	PMID: 27820421
Functional and Structural Analyses of CYP1B1 Variants Linked to Congenital and Adult-Onset Glaucoma to Investigate the Molecular Basis of These Diseases.	Banerjee A	PloS one	2016	PMID: 27243976
Mutational screening of CYP1B1 in Turkish PCG families and functional analyses of newly detected mutations.	Bagiyeva S	Molecular vision	2007	PMID: 17893647

Text-mined citations for this variant ...

Record last updated Oct 08, 2024

ClinVar Genomic variation as it relates to human health

NM_000104.4(CYP1B1):c.346_363del (p.Asp116_Ala121del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...