VCV002675051.3 - ClinVar

NM_000400.4(ERCC2):c.1852_1871dup (p.Tyr625fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(3)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000400.4(ERCC2):c.1852_1871dup (p.Tyr625fs)

Variation ID: 2675051 Accession: VCV002675051.3

Type and length

Duplication, 20 bp

Location

Cytogenetic: 19q13.32 19: 45352776-45352777 (GRCh38) [ NCBI UCSC ] 19: 45856034-45856035 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 30, 2023	Oct 26, 2024	Aug 12, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_000400.4:c.1852_1871dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000391.1:p.Tyr625fs	frameshift
NM_000400.4:c.1852_1871dup20 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NC_000019.10:g.45352779_45352798dup
NC_000019.9:g.45856037_45856056dup
NG_007067.2:g.22792_22811dup
LRG_461:g.22792_22811dup
LRG_461t1:c.1850_1869dup	LRG_461p1:p.Tyr625Serfs

... more HGVS ... less HGVS

Protein change

Y625fs

Other names

Canonical SPDI

NC_000019.10:45352776:GGGACGCCAAACATGATGACGG:GGGACGCCAAACATGATGACGGGACGCCAAACATGATGACGG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ERCC2		-	-	GRCh38 GRCh37	2131	2185

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Cerebrooculofacioskeletal syndrome 2	Likely pathogenic (1)	criteria provided, single submitter	May 31, 2023	RCV003467927.1
not provided	Pathogenic (1)	criteria provided, single submitter	Jan 15, 2024	RCV003679214.2
Xeroderma pigmentosum	Pathogenic (1)	criteria provided, single submitter	Aug 12, 2024	RCV004765844.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (May 31, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Cerebrooculofacioskeletal syndrome 2 Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004194668.1 First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023
Pathogenic (Jan 15, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004399700.1 First in ClinVar: Feb 20, 2024 Last updated: Feb 20, 2024	Publications: PubMed (3) PubMed: 9195225‚ 23232694‚ 25002996 Comment: This sequence change creates a premature translational stop signal (p.Tyr625Serfs91) in the ERCC2 gene. While this is not anticipated to result in nonsense mediated decay, … (more) This sequence change creates a premature translational stop signal (p.Tyr625Serfs91) in the ERCC2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 136 amino acid(s) of the ERCC2 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ERCC2-related conditions. This variant disrupts a region of the ERCC2 protein in which other variant(s) (p.Ala725Pro) have been determined to be pathogenic (PMID: 9195225, 23232694, 25002996). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Aug 12, 2024)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	Xeroderma pigmentosum Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV005381523.1 First in ClinVar: Oct 26, 2024 Last updated: Oct 26, 2024	Comment: Variant summary: ERCC2 c.1852_1871dup20 (p.Tyr625SerfsX91) results in a premature termination codon, predicted to cause a truncation of the encoded protein that is not expected to … (more) Variant summary: ERCC2 c.1852_1871dup20 (p.Tyr625SerfsX91) results in a premature termination codon, predicted to cause a truncation of the encoded protein that is not expected to elicit nonsense mediated decay. Multiple variants downstream from this position have been reported in affected individuals (HGMD) and been classified as pathogenic by our laboratory. The variant was absent in 251134 control chromosomes (gnomAD). To our knowledge, no occurrence of c.1852_1871dup20 in individuals affected with Xeroderma Pigmentosum and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 2675051). Based on the evidence outlined above, the variant was classified as pathogenic. (less)

Comment:

This sequence change creates a premature translational stop signal (p.Tyr625Serfs*91) in the ERCC2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 136 amino acid(s) of the ERCC2 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ERCC2-related conditions. This variant disrupts a region of the ERCC2 protein in which other variant(s) (p.Ala725Pro) have been determined to be pathogenic (PMID: 9195225, 23232694, 25002996). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.

Comment:

Variant summary: ERCC2 c.1852_1871dup20 (p.Tyr625SerfsX91) results in a premature termination codon, predicted to cause a truncation of the encoded protein that is not expected to elicit nonsense mediated decay. Multiple variants downstream from this position have been reported in affected individuals (HGMD) and been classified as pathogenic by our laboratory. The variant was absent in 251134 control chromosomes (gnomAD). To our knowledge, no occurrence of c.1852_1871dup20 in individuals affected with Xeroderma Pigmentosum and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 2675051). Based on the evidence outlined above, the variant was classified as pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Xeroderma Pigmentosum-Trichothiodystrophy overlap patient with novel XPD/ERCC2 mutation.	Kralund HH	Rare diseases (Austin, Tex.)	2013	PMID: 25002996
Abnormal XPD-induced nuclear receptor transactivation in DNA repair disorders: trichothiodystrophy and xeroderma pigmentosum.	Zhou X	European journal of human genetics : EJHG	2013	PMID: 23232694
DNA repair characteristics and mutations in the ERCC2 DNA repair and transcription gene in a trichothiodystrophy patient.	Takayama K	Human mutation	1997	PMID: 9195225

Text-mined citations for this variant ...

Record last updated Oct 27, 2024

ClinVar Genomic variation as it relates to human health

NM_000400.4(ERCC2):c.1852_1871dup (p.Tyr625fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...