VCV002645908.11 - ClinVar

NM_001318852.2(MAPK8IP3):c.602+7_602+56del

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(2)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Benign

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001318852.2(MAPK8IP3):c.602+7_602+56del

Variation ID: 2645908 Accession: VCV002645908.11

Type and length

Deletion, 50 bp

Location

Cytogenetic: 16p13.3 16: 1729569-1729618 (GRCh38) [ NCBI UCSC ] 16: 1779570-1779619 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Nov 20, 2023	Dec 22, 2024	Oct 1, 2022

HGVS

Nucleotide	Protein	Molecular consequence
NM_001318852.2:c.602+7_602+56del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		splice donor
NM_001040439.2:c.602+7_602+56del		splice donor
NM_001318852.1:c.602+7_602+56del50
NM_015133.5:c.602+7_602+56del		splice donor
NC_000016.10:g.1729585_1729634del
NC_000016.9:g.1779586_1779635del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000016.10:1729568:CGGGGCGGAGGTACGCGGGGCGCGGCGGGGTGGAGGTACGCGGGGCGCGGCGGGGCGGAGGTACGC:CGGGGCGGAGGTACGC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
MAPK8IP3		-	-	GRCh38 GRCh37	356	421

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Benign (1)	criteria provided, single submitter	Oct 1, 2022	RCV003395182.11
MAPK8IP3-related disorder	Likely benign (1)	no assertion criteria provided	Nov 8, 2019	RCV003985893.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Benign (Oct 01, 2022)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV004133728.11 First in ClinVar: Nov 20, 2023 Last updated: Dec 22, 2024	Comment: MAPK8IP3: BS1, BS2 Number of individuals with the variant: 3
Likely benign (Nov 08, 2019)	no assertion criteria provided Method: clinical testing	MAPK8IP3-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV004756442.2 First in ClinVar: Mar 16, 2024 Last updated: Oct 08, 2024	Comment: This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Dec 22, 2024

ClinVar Genomic variation as it relates to human health

NM_001318852.2(MAPK8IP3):c.602+7_602+56del

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...