VCV002078597.4 - ClinVar

NM_024120.5(NDUFAF5):c.183_190dup (p.Glu64fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(3)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_024120.5(NDUFAF5):c.183_190dup (p.Glu64fs)

Variation ID: 2078597 Accession: VCV002078597.4

Type and length

Microsatellite, 8 bp

Location

Cytogenetic: 20p12.1 20: 13785241-13785242 (GRCh38) [ NCBI UCSC ] 20: 13765887-13765888 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 8, 2023	Feb 14, 2024	Jan 24, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_024120.5:c.183_190dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_077025.2:p.Glu64fs	frameshift
NM_001039375.3:c.183_190dup	NP_001034464.1:p.Glu64fs	frameshift
NM_001352403.2:c.-193GCAGCCCG[3]		5 prime UTR
NM_001352406.2:c.-407GCAGCCCG[3]		5 prime UTR
NM_001352407.2:c.-521GCAGCCCG[3]		5 prime UTR
NM_001352408.2:c.183_190dup	NP_001339337.1:p.Glu64fs	frameshift
NM_024120.4:c.183_190dup
NR_029377.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147978.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147979.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147980.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147981.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147982.2:n.216GCAGCCCG[3]		non-coding transcript variant
NR_147983.2:n.216GCAGCCCG[3]		non-coding transcript variant
NC_000020.11:g.13785243GCAGCCCG[3]
NC_000020.10:g.13765889GCAGCCCG[3]
NG_015811.1:g.5218GCAGCCCG[3]
NG_015811.2:g.5217GCAGCCCG[3]
NG_142414.1:g.95GCAGCCCG[3]

... more HGVS ... less HGVS

Protein change

E64fs

Other names

Canonical SPDI

NC_000020.11:13785241:GGCAGCCCGGCAGCCCG:GGCAGCCCGGCAGCCCGGCAGCCCG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
LOC130065433	-	-	-	GRCh38	-	106
NDUFAF5		-	-	GRCh38 GRCh38 GRCh37	403	538

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic/Likely pathogenic (2)	criteria provided, multiple submitters, no conflicts	Jan 24, 2024	RCV002993854.4
Mitochondrial complex 1 deficiency, nuclear type 16	Likely pathogenic (1)	criteria provided, single submitter	Oct 27, 2023	RCV003465883.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Feb 19, 2023)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV004028352.1 First in ClinVar: Aug 26, 2023 Last updated: Aug 26, 2023	Comment: Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of … (more) Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge (less)
Likely pathogenic (Oct 27, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Mitochondrial complex 1 deficiency, nuclear type 16 Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004191998.1 First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023
Pathogenic (Jan 24, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV003291891.2 First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024	Publications: PubMed (3) PubMed: 26275793‚ 30473481‚ 32918965 Comment: This sequence change creates a premature translational stop signal (p.Glu64Glyfs11) in the NDUFAF5 gene. It is expected to result in an absent or disrupted protein … (more) This sequence change creates a premature translational stop signal (p.Glu64Glyfs11) in the NDUFAF5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NDUFAF5 are known to be pathogenic (PMID: 26275793, 30473481, 32918965). This variant is present in population databases (rs778103632, gnomAD 0.003%). This variant has not been reported in the literature in individuals affected with NDUFAF5-related conditions. ClinVar contains an entry for this variant (Variation ID: 2078597). For these reasons, this variant has been classified as Pathogenic. (less)

Comment:

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge

Comment:

This sequence change creates a premature translational stop signal (p.Glu64Glyfs*11) in the NDUFAF5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NDUFAF5 are known to be pathogenic (PMID: 26275793, 30473481, 32918965). This variant is present in population databases (rs778103632, gnomAD 0.003%). This variant has not been reported in the literature in individuals affected with NDUFAF5-related conditions. ClinVar contains an entry for this variant (Variation ID: 2078597). For these reasons, this variant has been classified as Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Nuclear DNA Mutation Causing a Phenotypic Leber Hereditary Optic Neuropathy Plus.	Mansukhani SA	Ophthalmology	2021	PMID: 32918965
Novel mutations in the mitochondrial complex I assembly gene NDUFAF5 reveal heterogeneous phenotypes.	Simon MT	Molecular genetics and metabolism	2019	PMID: 30473481
Reproductive genetic counseling challenges associated with diagnostic exome sequencing in a large academic private reproductive genetic counseling practice.	Westerfield LE	Prenatal diagnosis	2015	PMID: 26275793

Text-mined citations for this variant ...

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_024120.5(NDUFAF5):c.183_190dup (p.Glu64fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...