ClinVar Genomic variation as it relates to human health
NM_020975.6(RET):c.44TGC[7] (p.Leu19_Pro20insLeuLeu)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance(1); Likely benign(1)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_020975.6(RET):c.44TGC[7] (p.Leu19_Pro20insLeuLeu)
Variation ID: 1367349 Accession: VCV001367349.8
- Type and length
-
Microsatellite, 6 bp
- Location
-
Cytogenetic: 10q11.21 10: 43077301-43077302 (GRCh38) [ NCBI UCSC ] 10: 43572749-43572750 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 28, 2022 May 1, 2024 Jan 25, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_020975.6:c.44TGC[7] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_066124.1:p.Leu19_Pro20insLeuLeu inframe insertion NM_000323.2:c.44_46TGC[7] NP_000314.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406743.1:c.44_46TGC[7] NP_001393672.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406744.1:c.44_46TGC[7] NP_001393673.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406759.1:c.44_46TGC[7] NP_001393688.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406760.1:c.44_46TGC[7] NP_001393689.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406761.1:c.44_46TGC[7] NP_001393690.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406762.1:c.44_46TGC[7] NP_001393691.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406763.1:c.44_46TGC[7] NP_001393692.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406764.1:c.44_46TGC[7] NP_001393693.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406765.1:c.44_46TGC[7] NP_001393694.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406766.1:c.44_46TGC[7] NP_001393695.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406767.1:c.44_46TGC[7] NP_001393696.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406768.1:c.44_46TGC[7] NP_001393697.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406769.1:c.44_46TGC[7] NP_001393698.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406770.1:c.44_46TGC[7] NP_001393699.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406771.1:c.44_46TGC[7] NP_001393700.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406772.1:c.44_46TGC[7] NP_001393701.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406773.1:c.44_46TGC[7] NP_001393702.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406774.1:c.44_46TGC[7] NP_001393703.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406775.1:c.44_46TGC[7] NP_001393704.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406776.1:c.44_46TGC[7] NP_001393705.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406777.1:c.44_46TGC[7] NP_001393706.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406778.1:c.44_46TGC[7] NP_001393707.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406779.1:c.44_46TGC[7] NP_001393708.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406780.1:c.44_46TGC[7] NP_001393709.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406781.1:c.44_46TGC[7] NP_001393710.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406782.1:c.44_46TGC[7] NP_001393711.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406783.1:c.44_46TGC[7] NP_001393712.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406784.1:c.44_46TGC[7] NP_001393713.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406785.1:c.44_46TGC[7] NP_001393714.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406786.1:c.44_46TGC[7] NP_001393715.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406787.1:c.44_46TGC[7] NP_001393716.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406788.1:c.44_46TGC[7] NP_001393717.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406789.1:c.44_46TGC[7] NP_001393718.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406790.1:c.44_46TGC[7] NP_001393719.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406791.1:c.44_46TGC[7] NP_001393720.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406792.1:c.44_46TGC[7] NP_001393721.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406793.1:c.44_46TGC[7] NP_001393722.1:p.Leu19_Pro20insLeuLeu inframe indel NM_001406794.1:c.44_46TGC[7] NP_001393723.1:p.Leu19_Pro20insLeuLeu inframe indel NM_020629.2:c.44_46TGC[7] NP_065680.1:p.Leu19_Pro20insLeuLeu inframe indel NM_020630.7:c.44_46TGC[7] NP_065681.1:p.Leu19_Pro20insLeuLeu inframe indel NM_020975.4:c.44_46TGC[7] NP_066124.1:p.Leu19_Pro20insLeuLeu inframe indel NM_020975.4:c.53_58dupTGCTGC NC_000010.11:g.43077302TGC[7] NC_000010.10:g.43572750TGC[7] NG_007489.1:g.5234TGC[7] NG_045003.1:g.4489TGC[7] LRG_518:g.5234TGC[7] LRG_518t1:c.44_46TGC[7] LRG_518p1:p.Leu19_Pro20insLeuLeu LRG_518t2:c.44_46TGC[7] LRG_518p2:p.Leu19_Pro20insLeuLeu - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000010.11:43077301:TGCTGCTGCTGCTGC:TGCTGCTGCTGCTGCTGCTGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
RET | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
3598 | 3720 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Uncertain significance (1) |
criteria provided, single submitter
|
Jan 25, 2024 | RCV001962282.6 | |
Likely benign (1) |
criteria provided, single submitter
|
Dec 23, 2022 | RCV002343924.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Jan 25, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV002137215.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 20, 2024 |
Comment:
This variant, c.53_58dup, results in the insertion of 2 amino acid(s) of the RET protein (p.Leu18_Leu19dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.53_58dup, results in the insertion of 2 amino acid(s) of the RET protein (p.Leu18_Leu19dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1367349). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
|
|
Likely benign
(Dec 23, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002645712.3
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of … (more)
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs768132465 ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.