VCV000132150.22 - ClinVar

NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(8)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)

Variation ID: 132150 Accession: VCV000132150.22

Type and length

Deletion, 24 bp

Location

Cytogenetic: 1p36.21 1: 15445688-15445711 (GRCh38) [ NCBI UCSC ] 1: 15772183-15772206 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2013	May 1, 2024	Jan 2, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_007272.3:c.738_761del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_009203.2:p.Lys247_Arg254del	inframe deletion
NM_007272.2:c.738_761delCAAGAAGCCGGTAGTCTACACCCG
NC_000001.11:g.15445695_15445718del
NC_000001.10:g.15772190_15772213del
NG_009253.1:g.12253_12276del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000001.11:15445687:ACACCCGCAAGAAGCCGGTAGTCTACACCCG:ACACCCG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA345648 OMIM: 601405.0002 dbSNP: rs515726210 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
CTRC		-	-	GRCh38 GRCh37	604	633

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Hereditary pancreatitis	Pathogenic (4)	criteria provided, multiple submitters, no conflicts	Jan 2, 2024	RCV000119046.24
not specified	Pathogenic (1)	criteria provided, single submitter	Nov 20, 2016	RCV000506428.15
not provided	Pathogenic (2)	criteria provided, multiple submitters, no conflicts	Dec 17, 2022	RCV001270051.11
Pancreatitis, chronic, susceptibility to	risk factor (1)	no assertion criteria provided	Feb 1, 2008	RCV002267727.8

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 20, 2016)	criteria provided, single submitter (ARUP Molecular Germline Variant Investigation Process) Method: clinical testing	not specified Affected status: unknown Allele origin: germline	ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories Accession: SCV000603252.1 First in ClinVar: Sep 30, 2017 Last updated: Sep 30, 2017
Pathogenic (Nov 18, 2019)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Knight Diagnostic Laboratories, Oregon Health and Sciences University Accession: SCV001448783.1 First in ClinVar: Dec 12, 2020 Last updated: Dec 12, 2020	Number of individuals with the variant: 1 Clinical Features: Cerebellar ataxia (present) , Vestibular dysfunction (present) , Stage 3 chronic kidney disease (present) , Diabetes mellitus type 1 (present) Sex: female
Pathogenic (Dec 17, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: yes Allele origin: germline	Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital Accession: SCV002818160.1 First in ClinVar: Jan 07, 2023 Last updated: Jan 07, 2023
Pathogenic (Jan 31, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Hereditary pancreatitis Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004215234.1 First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023
Pathogenic (Sep 12, 2022)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Hereditary pancreatitis Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV001188716.4 First in ClinVar: Mar 16, 2020 Last updated: May 01, 2024	Publications: PubMed (2) PubMed: 18059268‚ 22942235 Comment: The c.738_761del24 pathogenic mutation (also known as p.K247_R254del) is located in coding exon 7 of the CTRC gene. This mutation results from an in-frame deletion … (more) The c.738_761del24 pathogenic mutation (also known as p.K247_R254del) is located in coding exon 7 of the CTRC gene. This mutation results from an in-frame deletion of 24 nucleotides between positions 738 and 761. This results in the deletion of 8 amino acids between codons 247 and 254. In one study, this mutation was significantly overrepresented in the pancreatitis group compared to controls (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82). In another study of individuals of European origin, this mutation was detected in 15/1739 (0.86%) affected individuals and 5/3586 (0.14%) controls (Beer S et al. Gut, 2013 Nov;62:1616-24). In vitro functional studies showed that protein with this variant is catalytically inactive, poorly secreted, and readily degraded by low concentrations of trypsin; the loss of function is hypothesized to increase the risk for chronic pancreatitis (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82; Beer S et al. Gut, 2013 Nov;62:1616-24). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
Pathogenic (Jan 02, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Hereditary pancreatitis Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000630756.7 First in ClinVar: Dec 26, 2017 Last updated: Feb 20, 2024	Publications: PubMed (6) PubMed: 28492532‚ 18059268‚ 18172691‚ 20625975‚ 22427236‚ 22942235 Comment: This variant, c.738_761del, results in the deletion of 8 amino acid(s) of the CTRC protein (p.Lys247_Arg254del), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.738_761del, results in the deletion of 8 amino acid(s) of the CTRC protein (p.Lys247_Arg254del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs746224507, gnomAD 0.01%). This variant has been observed in individual(s) with CTRC-associated pancreatitis, especially in the European population. In a compiled analysis of four case-control studies involving 1,739 cases and 3,686 controls, this variant was significantly associated with increased risk for pancreatitis (PMID: 18059268, 18172691, 20625975, 22427236, 22942235). ClinVar contains an entry for this variant (Variation ID: 132150). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTRC function (PMID: 18059268, 22942235). For these reasons, this variant has been classified as Pathogenic. (less)
risk factor (Feb 01, 2008)	no assertion criteria provided Method: literature only	PANCREATITIS, CHRONIC, SUSCEPTIBILITY TO Affected status: not provided Allele origin: germline	OMIM Accession: SCV000028867.1 First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013	Publications: PubMed (2) PubMed: 18059268‚ 18172691 Comment on evidence: Rosendahl et al. (2008) found that a 24-bp in-frame deletion in exon 7 of the CTRC gene (738_761del24, lys247_arg254del) was significantly overrepresented among 901 individuals … (more) Rosendahl et al. (2008) found that a 24-bp in-frame deletion in exon 7 of the CTRC gene (738_761del24, lys247_arg254del) was significantly overrepresented among 901 individuals of German origin with idiopathic or hereditary chronic pancreatitis (167800) (1.2%) compared to 2,804 German controls (0.1%, P = 0.00003). Allele frequency was 0.6% among 348 German individuals with alcohol-related chronic pancreatitis and 0.2% among 432 controls. This variant was not found among 71 Indian subjects with tropical pancreatitis (608189) and 84 controls of Indian origin. Masson et al. (2008) sequenced the CTRC gene in 287 white French patients with idiopathic chronic pancreatitis and identified the 24-bp deletion at nucleotide 738 in 2 sporadic patients and 1 of 350 controls. (less)
not provided (-)	no classification provided Method: literature only	Hereditary pancreatitis Affected status: yes Allele origin: germline	GeneReviews Accession: SCV000153752.3 First in ClinVar: May 31, 2014 Last updated: Oct 01, 2022	Publications: PubMed (1) PubMed: 18172691

Comment:

The c.738_761del24 pathogenic mutation (also known as p.K247_R254del) is located in coding exon 7 of the CTRC gene. This mutation results from an in-frame deletion of 24 nucleotides between positions 738 and 761. This results in the deletion of 8 amino acids between codons 247 and 254. In one study, this mutation was significantly overrepresented in the pancreatitis group compared to controls (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82). In another study of individuals of European origin, this mutation was detected in 15/1739 (0.86%) affected individuals and 5/3586 (0.14%) controls (Beer S et al. Gut, 2013 Nov;62:1616-24). In vitro functional studies showed that protein with this variant is catalytically inactive, poorly secreted, and readily degraded by low concentrations of trypsin; the loss of function is hypothesized to increase the risk for chronic pancreatitis (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82; Beer S et al. Gut, 2013 Nov;62:1616-24). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

Comment:

This variant, c.738_761del, results in the deletion of 8 amino acid(s) of the CTRC protein (p.Lys247_Arg254del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs746224507, gnomAD 0.01%). This variant has been observed in individual(s) with CTRC-associated pancreatitis, especially in the European population. In a compiled analysis of four case-control studies involving 1,739 cases and 3,686 controls, this variant was significantly associated with increased risk for pancreatitis (PMID: 18059268, 18172691, 20625975, 22427236, 22942235). ClinVar contains an entry for this variant (Variation ID: 132150). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTRC function (PMID: 18059268, 22942235). For these reasons, this variant has been classified as Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Pancreatitis Overview.	Adam MP	-	2020	PMID: 24624459
Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk.	Beer S	Gut	2013	PMID: 22942235
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?	Rosendahl J	Gut	2013	PMID: 22427236
Multifactorial genesis of pancreatitis in primary hyperparathyroidism: evidence for "protective" (PRSS2) and "destructive" (CTRC) genetic factors.	Felderbauer P	Experimental and clinical endocrinology & diabetes : official journal, German Society of Endocrinology [and] German Diabetes Association	2011	PMID: 20625975
Association of rare chymotrypsinogen C (CTRC) gene variations in patients with idiopathic chronic pancreatitis.	Masson E	Human genetics	2008	PMID: 18172691
Chymotrypsin C (CTRC) variants that diminish activity or secretion are associated with chronic pancreatitis.	Rosendahl J	Nature genetics	2008	PMID: 18059268

Text-mined citations for rs515726210 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 25, 2024

ClinVar Genomic variation as it relates to human health

NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs515726210 ...