VCV001256129.11 - ClinVar

NM_004960.3(FUS):c.515_523+3del

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(5)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Conflicting classifications of pathogenicity
Uncertain significance(3); Likely benign(2)

criteria provided, conflicting classifications

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_004960.3(FUS):c.515_523+3del

Variation ID: 1256129 Accession: VCV001256129.11

Type and length

Microsatellite, 12 bp

Location

Cytogenetic: 16p11.2 16: 31184372-31184383 (GRCh38) [ NCBI UCSC ] 16: 31195693-31195704 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Sep 19, 2021	Oct 8, 2024	May 10, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_004960.3:c.515_523+3del12
NC_000016.10:g.31184376GAGGTG[2]
NC_000016.9:g.31195697GAGGTG[2]
NG_012889.2:g.9245GAGGTG[2]
LRG_655:g.9245GAGGTG[2]
LRG_655t1:c.515_523+3del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000016.10:31184371:GGTGGAGGTGGAGGTGGAGGTGGAGGTG:GGTGGAGGTGGAGGTG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
FUS		-	-	GRCh38 GRCh37	537	556

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not specified	Likely benign (1)	criteria provided, single submitter	May 5, 2021	RCV001663471.11
Inborn genetic diseases	Uncertain significance (1)	criteria provided, single submitter	Jan 13, 2020	RCV002334640.9
Amyotrophic lateral sclerosis type 6 Tremor, hereditary essential, 4	Uncertain significance (1)	criteria provided, single submitter	May 10, 2023	RCV001882759.13
FUS-related disorder	Uncertain significance (1)	criteria provided, single submitter	Apr 24, 2023	RCV003416407.4
not provided	Likely benign (1)	criteria provided, single submitter	Oct 19, 2018	RCV004720932.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely benign (May 05, 2021)	criteria provided, single submitter (Athena Diagnostics criteria) Method: clinical testing	not specified Affected status: unknown Allele origin: unknown	Athena Diagnostics Accession: SCV001879952.1 First in ClinVar: Sep 19, 2021 Last updated: Sep 19, 2021
Uncertain significance (Apr 24, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	FUS-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV004116805.1 First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023	Comment: The FUS c.515_523+3del12 variant is predicted to result in a deletion affecting a canonical splice site. To our knowledge, this variant has not been reported … (more) The FUS c.515_523+3del12 variant is predicted to result in a deletion affecting a canonical splice site. To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.034% of alleles in individuals of Latino descent in gnomAD (http://gnomad.broadinstitute.org/variant/16-31195692-TGGTGGAGGTGGA-T). Although we suspect that this variant may be benign, at this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. (less)
Uncertain significance (May 10, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Tremor, hereditary essential, 4 Amyotrophic lateral sclerosis type 6 Explanation for multiple conditions: Uncertain. The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV002225192.3 First in ClinVar: Mar 28, 2022 Last updated: Feb 28, 2024	Comment: In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more) In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1256129). This variant has not been reported in the literature in individuals affected with FUS-related conditions. This variant is present in population databases (rs772959031, gnomAD 0.03%), and has an allele count higher than expected for a pathogenic variant. This variant, c.512_523del, results in the deletion of 4 amino acid(s) of the FUS protein (p.Gly172_Gly175del), but otherwise preserves the integrity of the reading frame. (less)
Uncertain significance (Jan 13, 2020)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV002641324.2 First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024	Comment: The c.515_523+3del12 variant results from a deletion of the last nine nucleotides of coding exon 5 and the first three nucleotides of intron 5 in … (more) The c.515_523+3del12 variant results from a deletion of the last nine nucleotides of coding exon 5 and the first three nucleotides of intron 5 in the FUS gene. These nucleotide positions are well conserved on available sequence alignment. Using the BDGP and ESEfinder splice site prediction tools, this alteration is not predicted to have any significant effect on this donor splice site; however, direct evidence is unavailable. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
Likely benign (Oct 19, 2018)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV005327508.1 First in ClinVar: Oct 08, 2024 Last updated: Oct 08, 2024	Comment: See Variant Classification Assertion Criteria.

Comment:

The FUS c.515_523+3del12 variant is predicted to result in a deletion affecting a canonical splice site. To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.034% of alleles in individuals of Latino descent in gnomAD (http://gnomad.broadinstitute.org/variant/16-31195692-TGGTGGAGGTGGA-T). Although we suspect that this variant may be benign, at this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence.

Comment:

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1256129). This variant has not been reported in the literature in individuals affected with FUS-related conditions. This variant is present in population databases (rs772959031, gnomAD 0.03%), and has an allele count higher than expected for a pathogenic variant. This variant, c.512_523del, results in the deletion of 4 amino acid(s) of the FUS protein (p.Gly172_Gly175del), but otherwise preserves the integrity of the reading frame.

Comment:

The c.515_523+3del12 variant results from a deletion of the last nine nucleotides of coding exon 5 and the first three nucleotides of intron 5 in the FUS gene. These nucleotide positions are well conserved on available sequence alignment. Using the BDGP and ESEfinder splice site prediction tools, this alteration is not predicted to have any significant effect on this donor splice site; however, direct evidence is unavailable. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Nov 25, 2024

ClinVar Genomic variation as it relates to human health

NM_004960.3(FUS):c.515_523+3del

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...