Variant allele predicted to encode a truncated non-functional protein.
ClinVar Genomic variation as it relates to human health
NM_007294.4(BRCA1):c.19_47del (p.Arg7fs)
Germline
Top reviewed classifications are shown here.
Submission summary:
Reviewed by expert panel
Pathogenic
Sep 2016 by
Evidence-based…
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_007294.4(BRCA1):c.19_47del (p.Arg7fs)
Variation ID: 125491 Accession: VCV000125491.16
- Type and length
-
Deletion, 29 bp
- Location
-
Cytogenetic: 17q21.31 17: 43124050-43124078 (GRCh38) [ NCBI UCSC ] 17: 41276067-41276095 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 4, 2014 May 1, 2024 Sep 8, 2016 - HGVS
- ... more HGVS ... less HGVS
- Protein change
- R7fs
- Other names
-
138del29
- Canonical SPDI
- NC_000017.11:43124049:TTAATGACATTTTGTACTTCTTCAACGCG:
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| BRCA1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
13050 | 14856 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (4) |
reviewed by expert panel
|
Sep 8, 2016 | RCV000111579.8 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 3, 2021 | RCV000163512.5 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 10, 2021 | RCV000792531.6 | |
| Pathogenic (1) |
criteria provided, single submitter
|
May 16, 2023 | RCV003477483.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Sep 08, 2016)
|
reviewed by expert panel
Method: curation
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Accession: SCV000299394.2
First in ClinVar: Sep 24, 2016 Last updated: Sep 24, 2016 |
Comment:
Variant allele predicted to encode a truncated non-functional protein.
|
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: yes
Allele origin:
germline
|
Biomedical Genomics and Oncogenetics Laboratory, Institut Pasteur de Tunis, University Tunis El Manar
Accession: SCV001519665.1
First in ClinVar: Mar 22, 2021 Last updated: Mar 22, 2021 |
Number of individuals with the variant: 1
Age: 30-39 years
Sex: female
Geographic origin: Tunisia
|
|
|
Pathogenic
(Oct 02, 2015)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge
Accession: SCV000325172.4
First in ClinVar: Nov 05, 2016 Last updated: Dec 11, 2022 |
|
|
|
Pathogenic
(May 16, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV004222578.1
First in ClinVar: Jan 06, 2024 Last updated: Jan 06, 2024 |
Comment:
The BRCA1 c.19_47del (p.Arg7Cysfs*24) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant … (more)
The BRCA1 c.19_47del (p.Arg7Cysfs*24) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has been reported in the published literature in affected individuals/families with a personal and/or family history of breast and/or ovarian cancer (PMIDs: 21120943 (2011), 22762150 (2012), 32341426 (2020), and 34490083 (2021)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. (less)
|
|
|
Pathogenic
(Sep 10, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000931834.4
First in ClinVar: Aug 14, 2019 Last updated: Feb 20, 2024 |
Comment:
This premature translational stop signal has been observed in individual(s) with personal or family history of breast and/or ovarian cancer (PMID: 21120943, 22762150, 27656653). For … (more)
This premature translational stop signal has been observed in individual(s) with personal or family history of breast and/or ovarian cancer (PMID: 21120943, 22762150, 27656653). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 125491). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Arg7Cysfs*24) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). (less)
|
|
|
Pathogenic
(Sep 03, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000214070.7
First in ClinVar: Mar 24, 2015 Last updated: May 01, 2024 |
Comment:
The c.19_47del29 pathogenic mutation, located in coding exon 1 of the BRCA1 gene, results from a deletion of 29 nucleotides at nucleotide positions 19 to … (more)
The c.19_47del29 pathogenic mutation, located in coding exon 1 of the BRCA1 gene, results from a deletion of 29 nucleotides at nucleotide positions 19 to 47, causing a translational frameshift with a predicted alternate stop codon (p.R7Cfs*24). In one study, this variant was observed in 1/1525 unrelated patients who had BRCA1/2 genetic testing due to a personal and/or family history suspicious for Hereditary Breast and/or Ovarian Cancer syndrome. (Caux-Moncoutier V et al. Hum Mutat, 2011 Mar;32:325-34). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
|
|
|
Pathogenic
(Jun 23, 1999)
|
no assertion criteria provided
Method: clinical testing
|
Breast-ovarian cancer, familial 1
Affected status: yes
Allele origin:
germline
|
Breast Cancer Information Core (BIC) (BRCA1)
Accession: SCV000144047.1
First in ClinVar: Apr 04, 2014 Last updated: Apr 04, 2014 |
Number of individuals with the variant: 1
|
Comment:
Comment:
The BRCA1 c.19_47del (p.Arg7Cysfs*24) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has been reported in the published literature in affected individuals/families with a personal and/or family history of breast and/or ovarian cancer (PMIDs: 21120943 (2011), 22762150 (2012), 32341426 (2020), and 34490083 (2021)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic.
Comment:
This premature translational stop signal has been observed in individual(s) with personal or family history of breast and/or ovarian cancer (PMID: 21120943, 22762150, 27656653). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 125491). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Arg7Cysfs*24) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584).
Comment:
The c.19_47del29 pathogenic mutation, located in coding exon 1 of the BRCA1 gene, results from a deletion of 29 nucleotides at nucleotide positions 19 to 47, causing a translational frameshift with a predicted alternate stop codon (p.R7Cfs*24). In one study, this variant was observed in 1/1525 unrelated patients who had BRCA1/2 genetic testing due to a personal and/or family history suspicious for Hereditary Breast and/or Ovarian Cancer syndrome. (Caux-Moncoutier V et al. Hum Mutat, 2011 Mar;32:325-34). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
Variant allele predicted to encode a truncated non-functional protein.
Comment:
The BRCA1 c.19_47del (p.Arg7Cysfs*24) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has been reported in the published literature in affected individuals/families with a personal and/or family history of breast and/or ovarian cancer (PMIDs: 21120943 (2011), 22762150 (2012), 32341426 (2020), and 34490083 (2021)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic.
Comment:
This premature translational stop signal has been observed in individual(s) with personal or family history of breast and/or ovarian cancer (PMID: 21120943, 22762150, 27656653). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 125491). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Arg7Cysfs*24) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584).
Comment:
The c.19_47del29 pathogenic mutation, located in coding exon 1 of the BRCA1 gene, results from a deletion of 29 nucleotides at nucleotide positions 19 to 47, causing a translational frameshift with a predicted alternate stop codon (p.R7Cfs*24). In one study, this variant was observed in 1/1525 unrelated patients who had BRCA1/2 genetic testing due to a personal and/or family history suspicious for Hereditary Breast and/or Ovarian Cancer syndrome. (Caux-Moncoutier V et al. Hum Mutat, 2011 Mar;32:325-34). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Identification of Eleven Novel BRCA Mutations in Tunisia: Impact on the Clinical Management of BRCA Related Cancers. | Hamdi Y | Frontiers in oncology | 2021 | PMID: 34490083 |
| Clinical outcome of breast cancer in carriers of BRCA1 and BRCA2 mutations according to molecular subtypes. | De Talhouet S | Scientific reports | 2020 | PMID: 32341426 |
| The spectrum of BRCA1 and BRCA2 pathogenic sequence variants in Middle Eastern, North African, and South European countries. | Laitman Y | Human mutation | 2019 | PMID: 31209999 |
| Improved Efficiency and Reliability of NGS Amplicon Sequencing Data Analysis for Genetic Diagnostic Procedures Using AGSA Software. | Poulet A | BioMed research international | 2016 | PMID: 27656653 |
| Streamlined ion torrent PGM-based diagnostics: BRCA1 and BRCA2 genes as a model. | Tarabeux J | European journal of human genetics : EJHG | 2014 | PMID: 23942203 |
| Variation in breast cancer risk associated with factors related to pregnancies according to truncating mutation location, in the French National BRCA1 and BRCA2 mutations carrier cohort (GENEPSO). | Lecarpentier J | Breast cancer research : BCR | 2012 | PMID: 22762150 |
| EMMA, a cost- and time-effective diagnostic method for simultaneous detection of point mutations and large-scale genomic rearrangements: application to BRCA1 and BRCA2 in 1,525 patients. | Caux-Moncoutier V | Human mutation | 2011 | PMID: 21120943 |
| Characterization of BRCA1 and BRCA2 deleterious mutations and variants of unknown clinical significance in unilateral and bilateral breast cancer: the WECARE study. | Borg A | Human mutation | 2010 | PMID: 20104584 |
Text-mined citations for rs80359871 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Oct 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.