ClinVar Genomic variation as it relates to human health
NM_001972.4(ELANE):c.68-145GATCCCGTGGGTTCCCGGTGGGG[3]
Germline
Classification
(1)
Likely benign
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
ELANE | Little evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh38 GRCh37 |
556 | 600 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Likely benign (1) |
|
Feb 3, 2020 | RCV001589650.3 |
Citations for germline classification of this variant
HelpText-mined citations for rs200116667 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Dec 25, 2023