In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1053894). This variant has not been reported in the literature in individuals affected with RET-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.35_52dup, results in the insertion of 6 amino acid(s) of the RET protein (p.Arg12_Leu17dup), but otherwise preserves the integrity of the reading frame.
ClinVar Genomic variation as it relates to human health
NM_020975.6(RET):c.35_52dup (p.Leu17_Leu18insArgLeuLeuLeuLeuLeu)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(2)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance
2
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_020975.6(RET):c.35_52dup (p.Leu17_Leu18insArgLeuLeuLeuLeuLeu)
Variation ID: 1053894 Accession: VCV001053894.11
- Type and length
-
Duplication, 18 bp
- Location
-
Cytogenetic: 10q11.21 10: 43077287-43077288 (GRCh38) [ NCBI UCSC ] 10: 43572735-43572736 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 13, 2021 May 1, 2024 Oct 27, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_020975.6:c.35_52dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_066124.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe insertion NM_000323.2:c.35_52dup NP_000314.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406743.1:c.35_52dup NP_001393672.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406744.1:c.35_52dup NP_001393673.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406759.1:c.35_52dup NP_001393688.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406760.1:c.35_52dup NP_001393689.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406761.1:c.35_52dup NP_001393690.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406762.1:c.35_52dup NP_001393691.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406763.1:c.35_52dup NP_001393692.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406764.1:c.35_52dup NP_001393693.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406765.1:c.35_52dup NP_001393694.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406766.1:c.35_52dup NP_001393695.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406767.1:c.35_52dup NP_001393696.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406768.1:c.35_52dup NP_001393697.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406769.1:c.35_52dup NP_001393698.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406770.1:c.35_52dup NP_001393699.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406771.1:c.35_52dup NP_001393700.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406772.1:c.35_52dup NP_001393701.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406773.1:c.35_52dup NP_001393702.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406774.1:c.35_52dup NP_001393703.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406775.1:c.35_52dup NP_001393704.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406776.1:c.35_52dup NP_001393705.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406777.1:c.35_52dup NP_001393706.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406778.1:c.35_52dup NP_001393707.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406779.1:c.35_52dup NP_001393708.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406780.1:c.35_52dup NP_001393709.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406781.1:c.35_52dup NP_001393710.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406782.1:c.35_52dup NP_001393711.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406783.1:c.35_52dup NP_001393712.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406784.1:c.35_52dup NP_001393713.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406785.1:c.35_52dup NP_001393714.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406786.1:c.35_52dup NP_001393715.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406787.1:c.35_52dup NP_001393716.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406788.1:c.35_52dup NP_001393717.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406789.1:c.35_52dup NP_001393718.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406790.1:c.35_52dup NP_001393719.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406791.1:c.35_52dup NP_001393720.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406792.1:c.35_52dup NP_001393721.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406793.1:c.35_52dup NP_001393722.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_001406794.1:c.35_52dup NP_001393723.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_020629.2:c.35_52dup NP_065680.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_020630.7:c.35_52dup NP_065681.1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu inframe indel NM_020975.4:c.35_52dupGTCTGCTGTTGCTGCTGC NC_000010.11:g.43077293_43077310dup NC_000010.10:g.43572741_43572758dup NG_007489.1:g.5225_5242dup NG_045003.1:g.4480_4497dup LRG_518:g.5225_5242dup LRG_518t1:c.35_52dup LRG_518p1:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu LRG_518t2:c.35_52dup LRG_518p2:p.Leu17_Leu18insArgLeuLeuLeuLeuLeu - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000010.11:43077287:GCTGCGTCTGCTGTTGCTGCTGC:GCTGCGTCTGCTGTTGCTGCTGCGTCTGCTGTTGCTGCTGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| RET | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
3598 | 3720 | |
| LOC106736614 | - | - | - | GRCh38 | - | 75 |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
Feb 20, 2022 | RCV001362298.9 | |
| Uncertain significance (1) |
criteria provided, single submitter
|
Oct 27, 2022 | RCV002456553.2 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(Feb 20, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001558309.4
First in ClinVar: Apr 13, 2021 Last updated: Feb 14, 2024 |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more)
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1053894). This variant has not been reported in the literature in individuals affected with RET-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.35_52dup, results in the insertion of 6 amino acid(s) of the RET protein (p.Arg12_Leu17dup), but otherwise preserves the integrity of the reading frame. (less)
|
|
|
Uncertain significance
(Oct 27, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002615098.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.35_52dup18 variant (also known as p.R12_L17dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 18 nucleotides at … (more)
The c.35_52dup18 variant (also known as p.R12_L17dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 18 nucleotides at nucleotide positions 35 to 52. This results in the duplication of 6 extra residues (RLLLLL) between codons 12 and 17. This amino acid region is conserved on limited sequence alignment. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
|
Comment:
Comment:
The c.35_52dup18 variant (also known as p.R12_L17dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 18 nucleotides at nucleotide positions 35 to 52. This results in the duplication of 6 extra residues (RLLLLL) between codons 12 and 17. This amino acid region is conserved on limited sequence alignment. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1053894). This variant has not been reported in the literature in individuals affected with RET-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.35_52dup, results in the insertion of 6 amino acid(s) of the RET protein (p.Arg12_Leu17dup), but otherwise preserves the integrity of the reading frame.
Comment:
The c.35_52dup18 variant (also known as p.R12_L17dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 18 nucleotides at nucleotide positions 35 to 52. This results in the duplication of 6 extra residues (RLLLLL) between codons 12 and 17. This amino acid region is conserved on limited sequence alignment. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs1837065209 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.