VCV001050334.3 - ClinVar

NM_004993.6(ATXN3):c.892CAG[17] (p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGln)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(2)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Benign

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_004993.6(ATXN3):c.892CAG[17] (p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGln)

Variation ID: 1050334 Accession: VCV001050334.3

Type and length

Microsatellite, 27 bp

Location

Cytogenetic: 14q32.12 14: 92071010-92071011 (GRCh38) [ NCBI UCSC ] 14: 92537354-92537355 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 13, 2021	Mar 4, 2023	Nov 27, 2020

HGVS

Nucleotide	Protein	Molecular consequence
NM_004993.6:c.892CAG[17] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_004984.2:p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001127696.2:c.847CAG[17]	NP_001121168.1:p.Gln290_Gly291insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001127697.3:c.739CAG[17]	NP_001121169.2:p.Gln254_Gly255insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001164774.2:c.209CAG[17]	NP_001158246.1:p.Ala77_Gly78insAlaAlaAlaAlaAlaAlaAlaAlaAla	inframe insertion
NM_001164776.2:c.254CAG[17]	NP_001158248.1:p.Ala92_Gly93insAlaAlaAlaAlaAlaAlaAlaAlaAla	inframe insertion
NM_001164777.2:c.89CAG[17]	NP_001158249.1:p.Ala37_Gly38insAlaAlaAlaAlaAlaAlaAlaAlaAla	inframe insertion
NM_001164778.2:c.407CAG[17]	NP_001158250.1:p.Ala143_Gly144insAlaAlaAlaAlaAlaAlaAlaAlaAla	inframe insertion
NM_001164779.2:c.529CAG[17]	NP_001158251.1:p.Gln184_Gly185insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001164780.2:c.355CAG[17]	NP_001158252.1:p.Gln126_Gly127insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001164781.2:c.682CAG[17]	NP_001158253.1:p.Gln235_Gly236insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NM_001164782.2:c.44CAG[17]	NP_001158254.1:p.Ala22_Gly23insAlaAlaAlaAlaAlaAlaAlaAlaAla	inframe insertion
NM_030660.5:c.727CAG[17]	NP_109376.1:p.Gln250_Gly251insGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe insertion
NR_028453.2:n.836CAG[17]		non-coding transcript variant
NR_028454.2:n.671CAG[17]		non-coding transcript variant
NR_028455.2:n.890CAG[17]		non-coding transcript variant
NR_028456.2:n.725CAG[17]		non-coding transcript variant
NR_028457.2:n.981CAG[17]		non-coding transcript variant
NR_028458.2:n.825CAG[17]		non-coding transcript variant
NR_028459.2:n.976CAG[17]		non-coding transcript variant
NR_028460.2:n.351CAG[17]		non-coding transcript variant
NR_028461.2:n.834CAG[17]		non-coding transcript variant
NR_028462.2:n.813CAG[17]		non-coding transcript variant
NR_028463.2:n.525CAG[17]		non-coding transcript variant
NR_028464.2:n.823CAG[17]		non-coding transcript variant
NR_028465.2:n.845CAG[17]		non-coding transcript variant
NR_028466.2:n.471CAG[17]		non-coding transcript variant
NR_028467.2:n.837CAG[17]		non-coding transcript variant
NR_028468.2:n.669CAG[17]		non-coding transcript variant
NR_028469.2:n.683CAG[17]		non-coding transcript variant
NR_028470.2:n.141CAG[17]		non-coding transcript variant
NR_031765.2:n.338CAG[17]		non-coding transcript variant
NC_000014.9:g.92071011CTG[17]
NC_000014.8:g.92537355CTG[17]
NG_008198.2:g.40588CAG[17]
NG_051545.1:g.101CTG[17]
LRG_865:g.40588CAG[17]
LRG_865t1:c.892CAG[17]	LRG_865p1:p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGln

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000014.9:92071010:CTGCTGCTGCTGCTGCTGCTGCTG:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs193922928 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ATXN3		-	-	GRCh38 GRCh37	30	74
LOC108663987	-	-	-	GRCh38	-	29

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Benign (2)	criteria provided, single submitter	Nov 27, 2020	RCV001357622.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Benign (Nov 27, 2020)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001942552.2 First in ClinVar: Sep 29, 2021 Last updated: Mar 04, 2023
Likely benign (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: unknown	Department of Pathology and Laboratory Medicine, Sinai Health System Additional submitter: Franklin by Genoox Study: The Canadian Open Genetics Repository (COGR) Accession: SCV001553143.1 First in ClinVar: Apr 13, 2021 Last updated: Apr 13, 2021	Comment: The ATXN3 p.Ala22_Gly23ins9 variant was identified in dbSNP (ID: rs763541221), ClinVar, Cosmic and LOVD 3.0. The variant was not identified in the following control databases: … (more) The ATXN3 p.Ala22_Gly23ins9 variant was identified in dbSNP (ID: rs763541221), ClinVar, Cosmic and LOVD 3.0. The variant was not identified in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This variant is an in-frame insertion resulting in the inclusion of nine CAG repeats. The (CAG)n repeat within the ATXN3 gene was found to cause Machado-Joseph disease at 73-78 repeats while 14-40 repeats was considered the normal range (Limprasert_1996_PMID: 8824876). More recent studies have suggested 52 to 86 repeats as pathogenic (GeneReviews). This CAG repeat expansion would fall within the normal range and this variant is predicted to be a polymorphism by MutationTaster. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more benign role for this variant. This variant is classified as likely benign. (less)

Comment:

The ATXN3 p.Ala22_Gly23ins9 variant was identified in dbSNP (ID: rs763541221), ClinVar, Cosmic and LOVD 3.0. The variant was not identified in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This variant is an in-frame insertion resulting in the inclusion of nine CAG repeats. The (CAG)n repeat within the ATXN3 gene was found to cause Machado-Joseph disease at 73-78 repeats while 14-40 repeats was considered the normal range (Limprasert_1996_PMID: 8824876). More recent studies have suggested 52 to 86 repeats as pathogenic (GeneReviews). This CAG repeat expansion would fall within the normal range and this variant is predicted to be a polymorphism by MutationTaster. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more benign role for this variant. This variant is classified as likely benign.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs193922928 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Dec 25, 2023

ClinVar Genomic variation as it relates to human health

NM_004993.6(ATXN3):c.892CAG[17] (p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGln)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs193922928 ...