This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1020843). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
ClinVar Genomic variation as it relates to human health
NM_020975.6(RET):c.5_28dup (p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(3)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance
3
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_020975.6(RET):c.5_28dup (p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla)
Variation ID: 1020843 Accession: VCV001020843.13
- Type and length
-
Duplication, 24 bp
- Location
-
Cytogenetic: 10q11.21 10: 43077260-43077261 (GRCh38) [ NCBI UCSC ] 10: 43572708-43572709 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 14, 2021 Aug 11, 2024 Jun 5, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_020975.6:c.5_28dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_066124.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe insertion initiator codon variant NM_000323.2:c.5_28dup NP_000314.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406743.1:c.5_28dup NP_001393672.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406744.1:c.5_28dup NP_001393673.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406759.1:c.5_28dup NP_001393688.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406760.1:c.5_28dup NP_001393689.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406761.1:c.5_28dup NP_001393690.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406762.1:c.5_28dup NP_001393691.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406763.1:c.5_28dup NP_001393692.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406764.1:c.5_28dup NP_001393693.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406765.1:c.5_28dup NP_001393694.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406766.1:c.5_28dup NP_001393695.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406767.1:c.5_28dup NP_001393696.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406768.1:c.5_28dup NP_001393697.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406769.1:c.5_28dup NP_001393698.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406770.1:c.5_28dup NP_001393699.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406771.1:c.5_28dup NP_001393700.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406772.1:c.5_28dup NP_001393701.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406773.1:c.5_28dup NP_001393702.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406774.1:c.5_28dup NP_001393703.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406775.1:c.5_28dup NP_001393704.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406776.1:c.5_28dup NP_001393705.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406777.1:c.5_28dup NP_001393706.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406778.1:c.5_28dup NP_001393707.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406779.1:c.5_28dup NP_001393708.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406780.1:c.5_28dup NP_001393709.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406781.1:c.5_28dup NP_001393710.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406782.1:c.5_28dup NP_001393711.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406783.1:c.5_28dup NP_001393712.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406784.1:c.5_28dup NP_001393713.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406785.1:c.5_28dup NP_001393714.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406786.1:c.5_28dup NP_001393715.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406787.1:c.5_28dup NP_001393716.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406788.1:c.5_28dup NP_001393717.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406789.1:c.5_28dup NP_001393718.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406790.1:c.5_28dup NP_001393719.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406791.1:c.5_28dup NP_001393720.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406792.1:c.5_28dup NP_001393721.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406793.1:c.5_28dup NP_001393722.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_001406794.1:c.5_28dup NP_001393723.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_020629.2:c.5_28dup NP_065680.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_020630.7:c.5_28dup NP_065681.1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla inframe indel NM_020975.4:c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG NC_000010.11:g.43077263_43077286dup NC_000010.10:g.43572711_43572734dup NG_007489.1:g.5195_5218dup NG_045003.1:g.4450_4473dup LRG_518:g.5195_5218dup LRG_518t1:c.5_28dup LRG_518p1:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla LRG_518t2:c.5_28dup LRG_518p2:p.Ala9_Gly10insAlaLysAlaThrSerGlyAlaAla - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000010.11:43077260:GGCGAAGGCGACGTCCGGTGCCGCGG:GGCGAAGGCGACGTCCGGTGCCGCGGCGAAGGCGACGTCCGGTGCCGCGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| RET | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
3598 | 3720 | |
| LOC106736614 | - | - | - | GRCh38 | - | 75 |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
Sep 13, 2023 | RCV001320496.11 | |
| Uncertain significance (1) |
criteria provided, single submitter
|
Jun 5, 2024 | RCV002350589.5 | |
| Uncertain significance (1) |
criteria provided, single submitter
|
Aug 15, 2023 | RCV003321826.2 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(Sep 13, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 2
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001511285.5
First in ClinVar: Mar 14, 2021 Last updated: Feb 20, 2024 |
Comment:
This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1020843). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
|
|
|
Uncertain significance
(Jun 05, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002645452.4
First in ClinVar: Nov 29, 2022 Last updated: Aug 11, 2024 |
Comment:
The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at … (more)
The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 5 to 28. This results in the duplication of 8 extra residues (AKATSGAA) between codons 2 and 9. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
|
|
|
Uncertain significance
(Aug 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital
Accession: SCV004027561.2
First in ClinVar: Aug 19, 2023 Last updated: Sep 03, 2023 |
|
Comment:
Comment:
The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 5 to 28. This results in the duplication of 8 extra residues (AKATSGAA) between codons 2 and 9. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1020843). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Comment:
The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 5 to 28. This results in the duplication of 8 extra residues (AKATSGAA) between codons 2 and 9. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs1837063549 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.