NM_001018116.2(CAVIN4):c.721CTGAGACAGTCAGGGGAGAGG[1] (p.234LRQSGER[2]) AND not provided
- Germline classification:
- Likely benign (1 submission)
- Last evaluated:
- Jun 21, 2021
- Review status:
- Somatic classification
of clinical impact: - None
- Review status:
- Somatic classification
of oncogenicity: - None
- Review status:
- Record status:
- current
- Accession:
- RCV001718943.10
Allele description [Variation Report for NM_001018116.2(CAVIN4):c.721CTGAGACAGTCAGGGGAGAGG[1] (p.234LRQSGER[2])]
NM_001018116.2(CAVIN4):c.721CTGAGACAGTCAGGGGAGAGG[1] (p.234LRQSGER[2])
Condition(s)
- Synonyms:
- none provided
- Identifiers:
- MedGen: C3661900
Assertion and evidence details
Last Updated: Nov 24, 2024