U.S. flag

An official website of the United States government

NM_000179.3(MSH6):c.3744_3773del (p.His1248_Ser1257del) AND Hereditary nonpolyposis colon cancer

Germline classification:
Likely pathogenic (1 submission)
Last evaluated:
Apr 8, 2021
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001375485.1

Allele description [Variation Report for NM_000179.3(MSH6):c.3744_3773del (p.His1248_Ser1257del)]

NM_000179.3(MSH6):c.3744_3773del (p.His1248_Ser1257del)

Gene:
MSH6:mutS homolog 6 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
2p16.3
Genomic location:
Preferred name:
NM_000179.3(MSH6):c.3744_3773del (p.His1248_Ser1257del)
HGVS:
  • NC_000002.12:g.47806301_47806330del
  • NG_007111.1:g.28155_28184del
  • NG_008397.1:g.104350_104379del
  • NM_000179.3:c.3744_3773delMANE SELECT
  • NM_001281492.2:c.3354_3383del
  • NM_001281493.2:c.2838_2867del
  • NM_001281494.2:c.2838_2867del
  • NP_000170.1:p.His1248_Ser1257del
  • NP_000170.1:p.His1248_Ser1257del
  • NP_001268421.1:p.His1118_Ser1127del
  • NP_001268422.1:p.His946_Ser955del
  • NP_001268423.1:p.His946_Ser955del
  • LRG_219t1:c.3744_3773del
  • LRG_219:g.28155_28184del
  • LRG_219p1:p.His1248_Ser1257del
  • NC_000002.11:g.48033436_48033465del
  • NC_000002.11:g.48033440_48033469del
  • NM_000179.2:c.3744_3773del
  • NM_000179.2:c.3744_3773del
  • NM_000179.2:c.3744_3773del30
  • NM_000179.2:c.3744_3773del30
  • NM_000179.2:c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA
Links:
dbSNP: rs863225412
NCBI 1000 Genomes Browser:
rs863225412
Molecular consequence:
  • NM_000179.3:c.3744_3773del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001281492.2:c.3354_3383del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001281493.2:c.2838_2867del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001281494.2:c.2838_2867del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Hereditary nonpolyposis colon cancer (HNPCC)
Synonyms:
Hereditary nonpolyposis colorectal cancer; Familial nonpolyposis colon cancer; Hereditary Nonpolyposis Colorectal Cancer Syndrome
Identifiers:
MONDO: MONDO:0018630; MedGen: C1333990; OMIM: PS120435

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000917780Women's Health and Genetics/Laboratory Corporation of America, LabCorp
criteria provided, single submitter

(LabCorp Variant Classification Summary - May 2015)
Likely pathogenic
(Apr 8, 2021)
germlineclinical testing

PubMed (2)
[See all records that cite these PMIDs]

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Association Between Inherited Germline Mutations in Cancer Predisposition Genes and Risk of Pancreatic Cancer.

Hu C, Hart SN, Polley EC, Gnanaolivu R, Shimelis H, Lee KY, Lilyquist J, Na J, Moore R, Antwi SO, Bamlet WR, Chaffee KG, DiCarlo J, Wu Z, Samara R, Kasi PM, McWilliams RR, Petersen GM, Couch FJ.

JAMA. 2018 Jun 19;319(23):2401-2409. doi: 10.1001/jama.2018.6228.

PubMed [citation]
PMID:
29922827
PMCID:
PMC6092184

Immune Profiling of Premalignant Lesions in Patients With Lynch Syndrome.

Chang K, Taggart MW, Reyes-Uribe L, Borras E, Riquelme E, Barnett RM, Leoni G, San Lucas FA, Catanese MT, Mori F, Diodoro MG, You YN, Hawk ET, Roszik J, Scheet P, Kopetz S, Nicosia A, Scarselli E, Lynch PM, McAllister F, Vilar E.

JAMA Oncol. 2018 Aug 1;4(8):1085-1092. doi: 10.1001/jamaoncol.2018.1482.

PubMed [citation]
PMID:
29710228
PMCID:
PMC6087485

Details of each submission

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV000917780.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (2)

Description

Variant summary: MSH6 c.3744_3773del30 (p.His1248_Ser1257del) results in an in-frame deletion that is predicted to remove 10 amino acids from the encoded protein. The variant allele was found at a frequency of 4e-06 in 251206 control chromosomes. c.3744_3773del30 has been reported in the literature in individuals affected with Lynch Syndrome (Chang_2018). These data do not allow any conclusion about variant significance. Co-occurrences with a pathogenic variant has been reported (APC c.487C>T, p.Gln163X), providing supporting evidence for a benign role. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and indicated that this variant co-segregates with lynch syndrome-related cancers in multiple families. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024