U.S. flag

An official website of the United States government

NM_000256.3(MYBPC3):c.3628-41_3628-17del AND Hypertrophic cardiomyopathy 4

Germline classification:
Likely benign (2 submissions)
Last evaluated:
Oct 31, 2024
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001254179.4

Allele description [Variation Report for NM_000256.3(MYBPC3):c.3628-41_3628-17del]

NM_000256.3(MYBPC3):c.3628-41_3628-17del

Gene:
MYBPC3:myosin binding protein C3 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
11p11.2
Genomic location:
Preferred name:
NM_000256.3(MYBPC3):c.3628-41_3628-17del
HGVS:
  • NC_000011.10:g.47332282_47332306del
  • NG_007667.1:g.25404_25428del
  • NM_000256.3:c.3628-41_3628-17delMANE SELECT
  • LRG_386t1:c.3628-41_3628-17del
  • LRG_386:g.25404_25428del
  • NC_000011.10:g.47332275_47332299delGAGAGGGAGGGAAGCCATCCAGGCT
  • NC_000011.9:g.47353833_47353857del
  • NM_000256.3:c.3628-41_3628-17del25MANE SELECT
  • NM_000256.3:c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTCMANE SELECT
Links:
dbSNP: rs36212066
NCBI 1000 Genomes Browser:
rs36212066
Functional consequence:
functional variant [Sequence Ontology: SO:0001536]

Condition(s)

Name:
Hypertrophic cardiomyopathy 4
Synonyms:
Familial hypertrophic cardiomyopathy 4
Identifiers:
MONDO: MONDO:0007268; MedGen: C1861862; OMIM: 115197

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001427228Clinical Genomics Laboratory, Stanford Medicine
no assertion criteria provided
Likely pathogenic
(Mar 12, 2020)
germlineclinical testing

SCV002517748Mendelics
criteria provided, single submitter

(Mendelics Assertion Criteria 2019)
Likely benign
(Oct 31, 2024)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Clinical Genomics Laboratory, Stanford Medicine, SCV001427228.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providedclinical testingnot provided

Description

The c.3628-41_3628-17del25 variant in the MYBPC3 gene has been previously reported in the heterozygous, compound heterozygous, or homozygous state in >30 unrelated individuals with cardiomyopathy (Alfares et al., 2015; Bashyam et al., 2012; Dhandapany et al., 2009; Waldmuller et al., 2003). The c.3628-41_3628-17del25 variant has also been identified in 981/30,592 South Asian chromosomes, including 19 homozygotes, by the Genome Aggregation Database (http://gnomad.broadinstitute.org/), indicating it may be a common, reduced penetrance allele in this population. While the c.3628-41_3628-17del25 variant is relatively common in individuals of South Asian ancestry, case-control studies have found an associated risk with cardiomyopathy (Dhandapany et al., 2009). This variant is predicted to disrupt splicing and lead to skipping of exon 33, reducing the length of the protein (Dhandapany et al., 2009; Waldmuller et al., 2003). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the c.3628-41_3628- 17del25 variant as likely pathogenic with reduced penetrance for hypertrophic cardiomyopathy in an autosomal dominant manner based on the information above. [ACMG evidence codes used: PS4; PM4]

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

From Mendelics, SCV002517748.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The NM_000256.3(MYBPC3):c.3628-41_3628-17del variant (rs36212066) has a GnomAD 4.1.0 frequency of 0.001855 (2992 heterozygotes) with 67 homozygotes. This frequency and the number of homozygotes are not compatible to a variant causing the disease.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Nov 24, 2024