NC_000023.11:g.70027876_70027911del AND Hypohidrotic X-linked ectodermal dysplasia

Germline classification:: Pathogenic (3 submissions)
Last evaluated:: Feb 19, 2024
Review status:: 2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000694688.9

Allele description [Variation Report for NC_000023.11:g.70027876_70027911del]

NC_000023.11:g.70027876_70027911del

Gene:

EDA:ectodysplasin A [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

Xq13.1

Genomic location:

Preferred name:

NC_000023.11:g.70027876_70027911del

HGVS:

NC_000023.11:g.70027876_70027911del
NG_009809.2:g.416810_416845del
NM_001005609.2:c.546_581del
NM_001005612.3:c.546_581del
NM_001399.5:c.546_581delMANE SELECT
NP_001005609.1:p.Asn185_Pro196del
NP_001005612.2:p.Asn185_Pro196del
NP_001390.1:p.Asn185_Pro196del
NC_000023.10:g.69247716_69247751del
NC_000023.10:g.69247726_69247761del
NM_001399.4:c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC
c.546_581del

Links:

dbSNP: rs397516665

NCBI 1000 Genomes Browser:

rs397516665

Observations:

Condition(s)

Name:: Hypohidrotic X-linked ectodermal dysplasia (XHED)
Synonyms:: ECTODERMAL DYSPLASIA, HYPOHIDROTIC, 1; Anhidrotic ectodermal dysplasia X-linked; Christ Siemens Touraine syndrome; See all synonyms [MedGen]
Identifiers:: MONDO: MONDO:0010585; MedGen: C0162359; Orphanet: 181; Orphanet: 238468; OMIM: 305100

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000060832	Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine	criteria provided, single submitter (LMM Criteria)	Pathogenic (Jan 30, 2018)	germline	clinical testing	PubMed (7) [See all records that cite these PMIDs] 18510547, 11279189, 9683615, 21357618, 9736768, 18231121, 24033266
SCV000823145	Labcorp Genetics (formerly Invitae), Labcorp	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (Aug 27, 2022)	germline	clinical testing	PubMed (6) [See all records that cite these PMIDs] 11279189, 9683615, 23553579, 31796081, 31924237, 28492532
SCV004698045	Institute of Human Genetics, University of Leipzig Medical Center	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Feb 19, 2024)	maternal	clinical testing	PubMed (1) [See all records that cite this PMID]

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000060832

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

criteria provided, single submitter

(LMM Criteria)

Pathogenic
(Jan 30, 2018)

germline

clinical testing

PubMed (7)
[See all records that cite these PMIDs]

SCV000823145

Labcorp Genetics (formerly Invitae), Labcorp

criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))

Pathogenic
(Aug 27, 2022)

germline

clinical testing

PubMed (6)
[See all records that cite these PMIDs]

SCV004698045

Institute of Human Genetics, University of Leipzig Medical Center

criteria provided, single submitter

(ACMG Guidelines, 2015)

Pathogenic
(Feb 19, 2024)

maternal

clinical testing

PubMed (1)
[See all records that cite this PMID]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	germline	not provided	4	2	not provided	not provided	not provided	clinical testing
not provided	maternal	yes	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

X-linked hypohidrotic ectodermal dysplasia. Genetic and dental findings in 67 Danish patients from 19 families.

Lexner MO, Bardow A, Juncker I, Jensen LG, Almer L, Kreiborg S, Hertz JM.

Clin Genet. 2008 Sep;74(3):252-9. doi: 10.1111/j.1399-0004.2008.01037.x. Epub 2008 May 28.

PubMed [citation]

PMID:: 18510547

Sweating ability and genotype in individuals with X-linked hypohidrotic ectodermal dysplasia.

Schneider H, Hammersen J, Preisler-Adams S, Huttner K, Rascher W, Bohring A.

J Med Genet. 2011 Jun;48(6):426-32. doi: 10.1136/jmg.2010.084012. Epub 2011 Feb 26.

PubMed [citation]

PMID:: 21357618

See all PubMed Citations (12)

Details of each submission

From Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine, SCV000060832.5

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	4	not provided	not provided	clinical testing	PubMed (7)

Description

The p.Asn185_Pro196del (c.546_581del and c.553_588del) in-frame deletion in EDA has been identified in >10 individuals with X-linked hypohidrotic ectodermal dys plasia (de novo in at least 2 of these individuals) and segregated with disease in 1 affected relative (Bayes 1998, Monreal 1998, Schneider 2001, Lexner 2008, v an der Hout 2008, Schneider 2011, LMM data). Two different deletions (c.546_581d el and c.553_588del), which result in the same p.Asn185_Pro196del in-frame delet ion, have been reported in the individuals described above. In summary, this var iant meets criteria to be classified as pathogenic for X-linked hypohidrotic ect odermal dysplasia based upon its identification in affected individuals and de n ovo occurrences. ACMG/AMP Criteria applied: PS4; PM6_Strong; PM4; PP4.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	not provided	not provided	not provided	not provided		4	not provided	2	not provided

From Labcorp Genetics (formerly Invitae), Labcorp, SCV000823145.4

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (6)

Description

For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant does not substantially affect EDA function (PMID: 11279189). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 44197). This variant has been observed in individual(s) with ectodermal dysplasia (PMID: 9683615, 23553579, 31796081, 31924237). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.546_581del, results in the deletion of 12 amino acid(s) of the EDA protein (p.Asn185_Pro196del), but otherwise preserves the integrity of the reading frame.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Institute of Human Genetics, University of Leipzig Medical Center, SCV004698045.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (1)

Description

Criteria applied: PS2,PS4,PM4,PM2_SUP,PP4

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	maternal	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Oct 8, 2024

ClinVar

Relating variation to medicine