NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del) AND Hereditary pancreatitis

Germline classification:: Pathogenic (4 submissions)
Last evaluated:: Jan 2, 2024
Review status:: 2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000119046.24

Allele description [Variation Report for NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)]

NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)

Gene:

CTRC:chymotrypsin C [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

1p36.21

Genomic location:

Preferred name:

NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)

HGVS:

NC_000001.11:g.15445695_15445718del
NG_009253.1:g.12253_12276del
NM_007272.3:c.738_761delMANE SELECT
NP_009203.2:p.Lys247_Arg254del
NP_009203.2:p.Lys247_Arg254del
NC_000001.10:g.15772183_15772206del
NC_000001.10:g.15772190_15772213del
NM_007272.2:c.738_761del24
NM_007272.2:c.738_761delCAAGAAGCCGGTAGTCTACACCCG

Links:

OMIM: 601405.0002; dbSNP: rs515726210

NCBI 1000 Genomes Browser:

rs515726210

Molecular consequence:

NM_007272.3:c.738_761del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:: Hereditary pancreatitis (PCTT)
Synonyms:: Hereditary chronic pancreatitis
Identifiers:: MONDO: MONDO:0008185; MedGen: C0238339; Orphanet: 676; OMIM: 167800

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000153752	GeneReviews	no classification provided	not provided	germline	literature only	PubMed (1) [See all records that cite this PMID]
SCV000630756	Labcorp Genetics (formerly Invitae), Labcorp	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (Jan 2, 2024)	germline	clinical testing	PubMed (6) [See all records that cite these PMIDs] 18172691, 20625975, 22427236, 18059268, 22942235, 28492532
SCV001188716	Ambry Genetics	criteria provided, single submitter (Ambry Variant Classification Scheme 2023)	Pathogenic (Sep 12, 2022)	germline	clinical testing	PubMed (2) [See all records that cite these PMIDs] 18059268, 22942235 Citation Link,
SCV004215234	Baylor Genetics	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Jan 31, 2023)	unknown	clinical testing	PubMed (1) [See all records that cite this PMID]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	yes	not provided	not provided	not provided	not provided	not provided	literature only
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	unknown	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Association of rare chymotrypsinogen C (CTRC) gene variations in patients with idiopathic chronic pancreatitis.

Masson E, Chen JM, Scotet V, Le Maréchal C, Férec C.

Hum Genet. 2008 Feb;123(1):83-91. doi: 10.1007/s00439-007-0459-3. Epub 2008 Jan 3.

PubMed [citation]

PMID:: 18172691

Multifactorial genesis of pancreatitis in primary hyperparathyroidism: evidence for "protective" (PRSS2) and "destructive" (CTRC) genetic factors.

Felderbauer P, Karakas E, Fendrich V, Lebert R, Bartsch DK, Bulut K.

Exp Clin Endocrinol Diabetes. 2011 Jan;119(1):26-9. doi: 10.1055/s-0030-1255106. Epub 2010 Jul 12.

PubMed [citation]

PMID:: 20625975

See all PubMed Citations (7)

Details of each submission

From GeneReviews, SCV000153752.3

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	literature only	PubMed (1)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Labcorp Genetics (formerly Invitae), Labcorp, SCV000630756.7

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (6)

Description

This variant, c.738_761del, results in the deletion of 8 amino acid(s) of the CTRC protein (p.Lys247_Arg254del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs746224507, gnomAD 0.01%). This variant has been observed in individual(s) with CTRC-associated pancreatitis, especially in the European population. In a compiled analysis of four case-control studies involving 1,739 cases and 3,686 controls, this variant was significantly associated with increased risk for pancreatitis (PMID: 18059268, 18172691, 20625975, 22427236, 22942235). ClinVar contains an entry for this variant (Variation ID: 132150). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTRC function (PMID: 18059268, 22942235). For these reasons, this variant has been classified as Pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Ambry Genetics, SCV001188716.4

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (2)

Description

The c.738_761del24 pathogenic mutation (also known as p.K247_R254del) is located in coding exon 7 of the CTRC gene. This mutation results from an in-frame deletion of 24 nucleotides between positions 738 and 761. This results in the deletion of 8 amino acids between codons 247 and 254. In one study, this mutation was significantly overrepresented in the pancreatitis group compared to controls (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82). In another study of individuals of European origin, this mutation was detected in 15/1739 (0.86%) affected individuals and 5/3586 (0.14%) controls (Beer S et al. Gut, 2013 Nov;62:1616-24). In vitro functional studies showed that protein with this variant is catalytically inactive, poorly secreted, and readily degraded by low concentrations of trypsin; the loss of function is hypothesized to increase the risk for chronic pancreatitis (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82; Beer S et al. Gut, 2013 Nov;62:1616-24). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Baylor Genetics, SCV004215234.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (1)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	unknown	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Nov 24, 2024

ClinVar

Relating variation to medicine