VCV000976784.5 - ClinVar

NM_078480.3(PUF60):c.612_630del (p.Asn207fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(4)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_078480.3(PUF60):c.612_630del (p.Asn207fs)

Variation ID: 976784 Accession: VCV000976784.5

Type and length

Deletion, 19 bp

Location

Cytogenetic: 8q24.3 8: 143818049-143818067 (GRCh38) [ NCBI UCSC ] 8: 144900219-144900237 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 21, 2020	Aug 15, 2022	Oct 2, 2021

HGVS

Nucleotide	Protein	Molecular consequence
NM_078480.3:c.612_630del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_510965.1:p.Asn207fs	frameshift
NM_001136033.3:c.483_501del	NP_001129505.1:p.Asn164fs	frameshift
NM_001271096.2:c.558_576del	NP_001258025.1:p.Asn189fs	frameshift
NM_001271097.2:c.474_492del	NP_001258026.1:p.Asn161fs	frameshift
NM_001271098.2:c.609_627del	NP_001258027.1:p.Asn206fs	frameshift
NM_001271099.2:c.525_543del	NP_001258028.1:p.Asn178fs	frameshift
NM_001271100.2:c.432_450del	NP_001258029.1:p.Asn147fs	frameshift
NM_001362895.2:c.723_741del	NP_001349824.1:p.Asn244fs	frameshift
NM_001362896.2:c.723_741del	NP_001349825.1:p.Asn244fs	frameshift
NM_001362897.2:c.672_690del	NP_001349826.1:p.Asn227fs	frameshift
NM_014281.5:c.561_579del	NP_055096.2:p.Asn190fs	frameshift
NC_000008.11:g.143818055_143818073del
NC_000008.10:g.144900225_144900243del
NG_030583.1:g.2313_2331del
NG_033879.1:g.16320_16338del

... more HGVS ... less HGVS

Protein change

N147fs, N161fs, N164fs, N178fs, N189fs, N190fs, N206fs, N207fs, N227fs, N244fs

Other names

Canonical SPDI

NC_000008.11:143818048:CTGCCCTATGTTGCTGGGTCTGCCC:CTGCCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1816565452 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
PUF60		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh38 GRCh37	197	271

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
8q24.3 microdeletion syndrome	Pathogenic/Likely pathogenic (4)	criteria provided, multiple submitters, no conflicts	Oct 2, 2021	RCV001254174.7

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Sep 07, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	8q24.3 microdeletion syndrome Affected status: yes Allele origin: unknown	Institute of Human Genetics, University of Leipzig Medical Center Accession: SCV001440335.2 First in ClinVar: Oct 31, 2020 Last updated: Sep 25, 2021
Pathogenic (Oct 02, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	8q24.3 microdeletion syndrome Affected status: yes Allele origin: unknown	3billion Accession: SCV002012275.1 First in ClinVar: Nov 11, 2021 Last updated: Nov 11, 2021	Comment: Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported … (more) Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant (PVS1_VS). It is not observed in the gnomAD v2.1.1 dataset (PM2). The variant has been reported as pathogenic (ClinVar ID: VCV000976784.3). Therefore, this variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. (less) Clinical Features: Wide nasal bridge (present) , Depressed glabella (present) , Frontal bossing (present) , Wide anterior fontanel (present) , Macrocephaly (present) , Mild short stature (present) … (more) Wide nasal bridge (present) , Depressed glabella (present) , Frontal bossing (present) , Wide anterior fontanel (present) , Macrocephaly (present) , Mild short stature (present) , Global developmental delay (present) , Preauricular skin tag (present) , Cryptorchidism (present) , Brachycephaly (present) , Motor delay (present) , Relative macrocephaly (present) , Short stature (present) (less)
Pathogenic (-)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	8q24.3 microdeletion syndrome Affected status: yes Allele origin: de novo	Centre de Biologie Pathologie Génétique, Centre Hospitalier Universitaire de Lille Accession: SCV002559173.1 First in ClinVar: Aug 15, 2022 Last updated: Aug 15, 2022
Pathogenic (Dec 19, 2019)	no assertion criteria provided Method: clinical testing	8q24.3 microdeletion syndrome (Autosomal dominant inheritance) Affected status: yes Allele origin: germline	Clinical Genomics Laboratory, Stanford Medicine Accession: SCV001427214.1 First in ClinVar: Aug 21, 2020 Last updated: Aug 21, 2020	Comment: The p.Asn207Profs3 variant in the PUF60 gene was identified de novo in this individual, but has not been previously reported in association with disease. This … (more) The p.Asn207Profs3 variant in the PUF60 gene was identified de novo in this individual, but has not been previously reported in association with disease. This variant was absent from large population databases, including the Genome Aggregation Database (http://gnomad.broadinstitute.org/). However, the ability to detect this type of variation is limited. This variant results in a 19 bp deletion, which causes a shift in the protein reading frame, leading to a premature termination codon 3 amino acids downstream. Heterozygous loss of function is an established mechanism of disease for the PUF60 gene. Additionally, a different nucleotide change (c.619_637del) resulting in an identical amino change (p.Asn207Profs3) has been previously reported de novo in an individual with features consistent with Verheij syndrome and is expected to result in a similar disruption to protein function as c.612_630del (Low et al., 2017). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the p.Asn207Profs3 variant as pathogenic for autosomal dominant Verheij syndrome based on the information above. [ACMG evidence codes used: PVS1, PS1, PS2_moderate, PM2_supporting] (less)

Comment:

Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant (PVS1_VS). It is not observed in the gnomAD v2.1.1 dataset (PM2). The variant has been reported as pathogenic (ClinVar ID: VCV000976784.3). Therefore, this variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline.

Comment:

The p.Asn207Profs*3 variant in the PUF60 gene was identified de novo in this individual, but has not been previously reported in association with disease. This variant was absent from large population databases, including the Genome Aggregation Database (http://gnomad.broadinstitute.org/). However, the ability to detect this type of variation is limited. This variant results in a 19 bp deletion, which causes a shift in the protein reading frame, leading to a premature termination codon 3 amino acids downstream. Heterozygous loss of function is an established mechanism of disease for the PUF60 gene. Additionally, a different nucleotide change (c.619_637del) resulting in an identical amino change (p.Asn207Profs*3) has been previously reported de novo in an individual with features consistent with Verheij syndrome and is expected to result in a similar disruption to protein function as c.612_630del (Low et al., 2017). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the p.Asn207Profs*3 variant as pathogenic for autosomal dominant Verheij syndrome based on the information above. [ACMG evidence codes used: PVS1, PS1, PS2_moderate, PM2_supporting]

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1816565452 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jul 07, 2024

ClinVar Genomic variation as it relates to human health

NM_078480.3(PUF60):c.612_630del (p.Asn207fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1816565452 ...