VCV000160028.34 - ClinVar

NM_001130438.3(SPTAN1):c.6899ACCAGCTGG[3] (p.2300DQL[3])

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(15)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001130438.3(SPTAN1):c.6899ACCAGCTGG[3] (p.2300DQL[3])

Variation ID: 160028 Accession: VCV000160028.34

Type and length

Microsatellite, 9 bp

Location

Cytogenetic: 9q34.11 9: 128632260-128632261 (GRCh38) [ NCBI UCSC ] 9: 131394539-131394540 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 7, 2015	May 1, 2024	May 5, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_001130438.3:c.6899ACCAGCTGG[3] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001123910.1:p.2300DQL[3]	inframe insertion
NM_001130438.3:c.6908_6916dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001130438.2:c.6908_6916dup9
NM_001130438.2:c.6908_6916dupACCAGCTGG
NM_001195532.2:c.6824ACCAGCTGG[3]	NP_001182461.1:p.2275DQL[3]	inframe insertion
NM_001363759.2:c.6962ACCAGCTGG[3]	NP_001350688.1:p.2321DQL[3]	inframe insertion
NM_001363765.2:c.6839ACCAGCTGG[3]	NP_001350694.1:p.2280DQL[3]	inframe insertion
NM_001375310.1:c.6986ACCAGCTGG[3]	NP_001362239.1:p.2329DQL[3]	inframe insertion
NM_001375311.2:c.6899ACCAGCTGG[3]	NP_001362240.1:p.2300DQL[3]	inframe insertion
NM_001375312.2:c.6935ACCAGCTGG[3]	NP_001362241.2:p.2312DQL[3]	inframe insertion
NM_001375313.1:c.6881ACCAGCTGG[3]	NP_001362242.1:p.2294DQL[3]	inframe insertion
NM_001375314.2:c.6839ACCAGCTGG[3]	NP_001362243.1:p.2280DQL[3]	inframe insertion
NM_001375318.1:c.6998ACCAGCTGG[3]	NP_001362247.1:p.2333DQL[3]	inframe insertion
NM_003127.4:c.6881_6882insGGACCAGCT
NM_003127.4:c.6884ACCAGCTGG[3]	NP_003118.2:p.2295DQL[3]	inframe insertion
NC_000009.12:g.128632263ACCAGCTGG[3]
NC_000009.11:g.131394542ACCAGCTGG[3]
NG_027748.1:g.84706ACCAGCTGG[3]
NG_034056.1:g.29573AGCTGGTCC[3]

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000009.12:128632260:GGACCAGCTGGACCAGCTGG:GGACCAGCTGGACCAGCTGGACCAGCTGG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA173597 OMIM: 182810.0005 dbSNP: rs587784440 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
SPTAN1		-	-	GRCh38 GRCh37	2660	2719

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Developmental and epileptic encephalopathy, 5	Pathogenic/Likely pathogenic (6)	criteria provided, multiple submitters, no conflicts	May 4, 2022	RCV000147656.25
not provided	Pathogenic (4)	criteria provided, multiple submitters, no conflicts	Dec 17, 2022	RCV000189556.20
Early infantile epileptic encephalopathy with suppression bursts	Pathogenic (1)	criteria provided, single submitter	Oct 13, 2022	RCV000696609.17
Undetermined early-onset epileptic encephalopathy	not provided (1)	no classification provided	-	RCV001249449.9
not specified	no classifications from unflagged records (1)	no classifications from unflagged records	-	RCV001731396.15
Inborn genetic diseases	Pathogenic (1)	criteria provided, single submitter	May 30, 2017	RCV002316953.9
SPTAN1-related disorder	Pathogenic (1)	criteria provided, single submitter	May 5, 2023	RCV004551285.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Sep 27, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000243199.9 First in ClinVar: Aug 07, 2015 Last updated: Mar 04, 2023	Comment: Published functional studies suggest this variant has a dominant negative effect on neurons, however additional studies are needed to validate the functional effect of this … (more) Published functional studies suggest this variant has a dominant negative effect on neurons, however additional studies are needed to validate the functional effect of this variant (Wang et al., 2018); In-frame duplication of three amino acids in a non-repeat region; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34440880, 22656320, 29337302, 29050398, 25631096) (less)
Pathogenic (Oct 13, 2022)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Early infantile epileptic encephalopathy with suppression bursts Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000825175.6 First in ClinVar: Oct 10, 2018 Last updated: Feb 14, 2024	Publications: PubMed (3) PubMed: 28492532‚ 22656320‚ 29050398 Comment: ClinVar contains an entry for this variant (Variation ID: 160028). This variant has been observed in individual(s) with West syndrome (PMID: 22656320, 29050398). In at … (more) ClinVar contains an entry for this variant (Variation ID: 160028). This variant has been observed in individual(s) with West syndrome (PMID: 22656320, 29050398). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.6908_6916dup, results in the insertion of 3 amino acid(s) of the SPTAN1 protein (p.Asp2303_Leu2305dup), but otherwise preserves the integrity of the reading frame. Experimental studies have shown that this variant affects SPTAN1 function (PMID: 29050398). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. (less)
Pathogenic (Feb 08, 2013)	criteria provided, single submitter (ACMG Guidelines, 2007) Method: clinical testing	Epileptic encephalopathy, early infantile, 5 Affected status: yes Allele origin: germline	Genetic Services Laboratory, University of Chicago Accession: SCV000195105.2 First in ClinVar: Nov 23, 2014 Last updated: Oct 05, 2015
Pathogenic (Aug 30, 2018)	criteria provided, single submitter (EGL ClinVar v180209 classification definitions) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Eurofins Ntd Llc (ga) Accession: SCV000862913.1 First in ClinVar: Aug 07, 2015 Last updated: Aug 07, 2015	Publications: PubMed (4) PubMed: 29050398‚ 29337302‚ 22656320‚ 25631096 Other databases http://www.egl-eurofins.com/emvc… http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=SPTAN1 Number of individuals with the variant: 1 Sex: mixed
Pathogenic (May 06, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Developmental and epileptic encephalopathy, 5 (Autosomal dominant inheritance) Affected status: yes Allele origin: unknown	Pediatrics, MediClubGeorgia Accession: SCV001573197.1 First in ClinVar: May 10, 2021 Last updated: May 10, 2021	Publications: DOI: 10.1093/brain/awx195 DOI: 10.1093/brain/awx195 Comment: This variant is absent in population databases. There is two submission on Clinvar with pathogenic interpretation. This variant has been observed in individual(s) with clinical … (more) This variant is absent in population databases. There is two submission on Clinvar with pathogenic interpretation. This variant has been observed in individual(s) with clinical features of SCN2A-related conditions. (less) Clinical Features: Infantile spasms (present) , Microcephaly (present) , Epileptic encephalopathy (present) , Hypotonia (present) , Hypsarrhythmia (present) Age: 0-9 years Sex: female Ethnicity/Population group: Caucasian Testing laboratory: Org:279559 Date variant was reported to submitter: 2020-01-08 Testing laboratory interpretation: Pathogenic
Likely pathogenic (Sep 01, 2017)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: research	Developmental and epileptic encephalopathy, 5 Affected status: unknown Allele origin: de novo	Institute of Human Genetics, University of Leipzig Medical Center Accession: SCV002026329.1 First in ClinVar: Nov 29, 2021 Last updated: Nov 29, 2021	Publications: PubMed (1) PubMed: 29050398
Pathogenic (May 04, 2022)	criteria provided, single submitter (Mendelics Assertion Criteria 2019) Method: clinical testing	Developmental and epileptic encephalopathy, 5 Affected status: unknown Allele origin: germline	Mendelics Accession: SCV002519815.1 First in ClinVar: May 28, 2022 Last updated: May 28, 2022
Pathogenic (Dec 17, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: yes Allele origin: germline	Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital Accession: SCV002818215.1 First in ClinVar: Jan 07, 2023 Last updated: Jan 07, 2023
Likely pathogenic (-)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Developmental and epileptic encephalopathy, 5 (Autosomal dominant inheritance) Affected status: yes Allele origin: germline	Lifecell International Pvt. Ltd Accession: SCV003924075.1 First in ClinVar: May 13, 2023 Last updated: May 13, 2023	Publications: PubMed (1) PubMed: 22656320 Comment: A Heterozygous Inframe indel variant c.6881_6882insGGACCAGCT in Exon 52 of the SPTAN1 gene that results in the amino acid substitution p.Trp2294_Asp2295insAspGlnLeu was identified. The observed … (more) A Heterozygous Inframe indel variant c.6881_6882insGGACCAGCT in Exon 52 of the SPTAN1 gene that results in the amino acid substitution p.Trp2294_Asp2295insAspGlnLeu was identified. The observed variant is novel in gnomAD exomes and genomes, respectively. The severity of the impact of this variant on the protein is medium, based on the effect of the protein and REVEL score. Rare Exome Variant Ensemble Learner (REVEL) is an ensembl method for predicting the pathogenicity of missense variants based on a combination of scores from 13 individual tools: MutPred, FATHMM v2.3, VEST 3.0, PolyPhen-2, SIFT, PROVEAN, MutationAssessor, MutationTaster, LRT, GERP++, SiPhy, phyloP, and phastCons. The REVEL score for an individual missense variant can range from 0 to 1, with higher scores reflecting greater likelihood that the variant is disease-causing. ClinVar has also classified this variant as Pathogenic/ LikelyPathogenic (Variant ID: 160028). This disorder has previously been reported in the patient affected with epilepsy (Nonoda Y et.al 2012). Based on the above evidence this variant has been classified as Likely Pathogenic according to the ACMG guidelines. (less) Ethnicity/Population group: Asian Geographic origin: India
Pathogenic (May 05, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	SPTAN1-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV004119798.1 First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023	Comment: The SPTAN1 c.6908_6916dup9 variant is predicted to result in an in-frame duplication (p.Asp2303_Leu2305dup). This variant has been reported as a recurrent de novo change in … (more) The SPTAN1 c.6908_6916dup9 variant is predicted to result in an in-frame duplication (p.Asp2303_Leu2305dup). This variant has been reported as a recurrent de novo change in multiple unrelated individuals affected with West syndrome with progressive brain atrophy and functional studies suggested that this variant causes aggregation of spectrin complexes in neurons via dominant-negative effects (Nonoda et al. 2013. PubMed ID: 22656320; Tohyama et al. 2015. PubMed ID: 25631096; Syrbe et al. 2017. PubMed ID: 29050398; Wang et al. 2018. PubMed ID: 29337302). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic. (less)
Pathogenic (Jun 28, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV002023644.3 First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024
Pathogenic (May 30, 2017)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV000849722.4 First in ClinVar: Nov 08, 2018 Last updated: May 01, 2024	Publications: PubMed (2) PubMed: 22656320‚ 25631096 Comment: The c.6908_6916dupACCAGCTGG pathogenic mutation (also known as p.D2303_L2305dup), located in coding exon 52 of the SPTAN1 gene, results from an in-frame duplication of ACCAGCTGG at … (more) The c.6908_6916dupACCAGCTGG pathogenic mutation (also known as p.D2303_L2305dup), located in coding exon 52 of the SPTAN1 gene, results from an in-frame duplication of ACCAGCTGG at nucleotide positions 6908 to 6916. This results in the duplication of 3 extra residues (DQL) between codons 2303 and 2305. This variant has been determined to be the result of a de novo mutation or germline mosaicism in one family with an isolated case of developmental delay, intellectual disability, and microcephaly. This duplication was also reported as a de novo occurrence in a 1-year-old male with West syndrome, hypomyelination of the cerebral white matter, and impaired psychomoter development (Nonoda Y et al. Brain Dev., 2013 Mar;35:280-3). The mutation occurs in the last two spectrin repeats of the SPTAN1 protein, where several in-frame duplications and deletions have been detected in patients with West syndrome (Tohyama J et al. J. Hum. Genet., 2015 Apr;60:167-73). In addition, this alteration is predicted to be deleterious by PROVEAN in silico analysis (Choi Y et al., PLoS ONE 2012; 7(10):e46688). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
Pathogenic (Mar 01, 2013)	no assertion criteria provided Method: literature only	DEVELOPMENTAL AND EPILEPTIC ENCEPHALOPATHY 5 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000223691.4 First in ClinVar: May 24, 2015 Last updated: Oct 21, 2023	Publications: PubMed (2) PubMed: 22656320‚ 29050398 Comment on evidence: In a 12-month-old Japanese boy with developmental and epileptic encephalopathy-5 (DEE5; 613477) who had a clinical diagnosis of West syndrome, Nonoda et al. (2013) identified … (more) In a 12-month-old Japanese boy with developmental and epileptic encephalopathy-5 (DEE5; 613477) who had a clinical diagnosis of West syndrome, Nonoda et al. (2013) identified a de novo heterozygous 9-bp duplication (c.6908_6916dup) in the SPTAN1 gene, resulting in a 3-residue duplication (Asp2303_Leu2305dup) in the last spectrin repeat. The mutation was not found in 250 Japanese control individuals. Functional studies of the variant were not performed. The patient had onset of epileptic spasms at age 3 months. In 3 unrelated patients (P10, P11, and P12) with DEE5 and West syndrome, Syrbe et al. (2017) identified a de novo heterozygous c.6908_6916dup mutation in the SPTAN1 gene. Fibroblasts from P10 showed abnormal aggregation of alpha-2 spectrin that colocalized with beta-2 spectrin and clustered near the plasma membrane. (less)
not provided (-)	no classification provided Method: phenotyping only	Undetermined early-onset epileptic encephalopathy Affected status: unknown Allele origin: de novo	GenomeConnect, ClinGen Accession: SCV001423461.1 First in ClinVar: Jul 19, 2020 Last updated: Jul 19, 2020	Comment: Variant interpretted as Pathogenic and reported on 08-28-2019 by Lab or GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided … (more) Variant interpretted as Pathogenic and reported on 08-28-2019 by Lab or GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. GenomeConnect staff make no attempt to reinterpret the clinical significance of the variant. (less) Clinical Features: Overgrowth (present) , Obesity (present) , Hemihypertrophy (present) , Short stature (present) , Failure to thrive (present) , Growth hormone deficiency (present) , Growth hormone … (more) Overgrowth (present) , Obesity (present) , Hemihypertrophy (present) , Short stature (present) , Failure to thrive (present) , Growth hormone deficiency (present) , Growth hormone excess (present) , Tall stature (present) , Abnormality of the nervous system (present) , Cerebral palsy (present) , Cognitive impairment (present) , Abnormality of coordination (present) , EEG abnormality (present) , Encephalopathy (present) , Hypertonia (present) , Generalized hypotonia (present) , Memory impairment (present) , Movement disorder (present) , Seizures (present) , Autistic behavior (present) , Bipolar affective disorder (present) , Schizophrenia (present) , Stereotypy (present) , Abnormal aggressive, impulsive or violent behavior (present) , Anxiety (present) , Depressivity (present) , Delusions (present) , Hallucinations (present) , Obsessive-compulsive behavior (present) , Psychosis (present) , Short attention span (present) , Atrophic scars (present) , Multiple cafe-au-lait spots (present) , Hyperpigmentation of the skin (present) , Hypopigmentation of the skin (present) , Hypohidrosis (present) , Hyperhidrosis (present) , Fragile skin (present) , Cutaneous photosensitivity (present) , Thickened skin (present) , Hyperextensible skin (present) , Cutis laxa (present) , Abnormality of limb bone morphology (present) , Abnormality of the curvature of the vertebral column (present) , Joint hypermobility (present) , Increased susceptibility to fractures (present) , Abnormality of digit (present) , Abnormality of the hand (present) , Abnormality of the foot (present) , Hip dysplasia (present) , Pectus carinatum (present) , Pectus excavatum (present) , Skeletal dysplasia (present) , Abnormality of facial musculature (present) , Abnormality of muscle physiology (present) , Abnormality of muscle morphology (present) , Abnormality of the somatic nervous system (present) , Abnormality of the musculature of the limbs (present) , Abnormality of the musculature (present) , Abnormality of the musculature of the pelvis (present) , Dilatation (present) , Arrhythmia (present) , Abnormal EKG (present) , Arterial dissection (present) , Cardiomyopathy (present) , Abnormality of the cardiovascular system (present) , Abnormality of cardiovascular system morphology (present) , Hypertensive disorder (present) , Hypercholesterolemia (present) , Stroke (present) , Asthma (present) , Abnormality of the respiratory system (present) , Decreased pulmonary function (present) , Abnormality of the diaphragm (present) , Respiratory insufficiency (present) , Restrictive ventilatory defect (present) , Abnormal pattern of respiration (present) , Abnormality of the upper respiratory tract (present) , Feeding difficulties (present) , Abnormality of esophagus morphology (present) , Abnormality of the stomach (present) , Abnormality of the pancreas (present) , Abnormality of the liver (present) , Gastrointestinal dysmotility (present) , Abnormality of the intestine (present) , Abnormality of the large intestine (present) , Abnormality of the anus (present) , Abnormality of the bladder (present) , Abnormal sex determination (present) , Abnormal renal physiology (present) , Abnormal renal morphology (present) , Abnormality of the female genitalia (present) , Abnormality of reproductive system physiology (present) , Abnormality of the male genitalia (present) , Abnormality of the urethra (present) , Abnormality of the ureter (present) , Abnormality of urine homeostasis (present) , Autoimmunity (present) , Immunodeficiency (present) , Abnormal inflammatory response (present) , Recurrent infections (present) , Rheumatoid arthritis (present) , Abnormal thrombosis (present) , Abnormality of coagulation (present) , Bleeding with minor or no trauma (present) , Bruising susceptibility (present) , Persistent bleeding after trauma (present) , Extramedullary hematopoiesis (present) , Epistaxis (present) , Abnormality of thrombocytes (present) , Abnormality of erythrocytes (present) , Abnormality of leukocytes (present) (less) Indication for testing: Not Provided Age: 0-9 years Sex: female Testing laboratory: GeneDx Date variant was reported to submitter: 2019-08-28 Testing laboratory interpretation: Pathogenic
Likely pathogenic (Jan 24, 2020)	Flagged submission flagged submission (ACMG Guidelines, 2015) Method: clinical testing Reason: This record appears to be redundant with a more recent record from the same submitter. Notes: SCV001984103 appears to (...more) Source: NCBI	not specified Affected status: yes Allele origin: germline	Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital Accession: SCV001984103.1 First in ClinVar: Oct 30, 2021 Last updated: Oct 30, 2021 Comment: The p.Asp2303_Leu2305dup variant in the SPTAN1 gene was initially reported as a de novo mutation in a child with West syndrome and hypomyelination2. Subsequently this … (more) The p.Asp2303_Leu2305dup variant in the SPTAN1 gene was initially reported as a de novo mutation in a child with West syndrome and hypomyelination2. Subsequently this variant was identified as de novo in 7 additional patients13. This duplication results in an in-frame duplication of three well-conserved amino acids in the last spectrin repeat starting with codon Aspartic Acid 2303 and ending at codon Leucine 2305. Previously reported pathogenic variants in SPTAN1 include in-frame deletions or duplications located within the last four spectrin repeats of the protein which are essential for dimerization14 and this variant is within the this region. In vitro functional studies indicated that this variant result in gain-of-function due to aggregation of αII spectrin1. The amino acid stretch extending from codons 2303-2309 is highly important for α/β spectrin heterodimerization and/or spectrin function in the brain and amino acid duplications that fall within this region have more severe consequences on spectrin dimer formation than deletions1. This variant is absent in control population databases. In summary this variant meets our criteria to be classified as pathogenic. SPTAN1-related encephalopathy has distinct clinical phenotypes including epileptic encephalopathy with hypsarrhythmia acquired microcephaly no visual attention spastic quadriplegia and severe Intellectual disability. Brainstem and cerebellar atrophy and cerebral hypomyelination identified by MRI are specific hallmarks of this disorder3. These phenotypes are caused by in-frame SPTAN1 mutations in the C-terminal region that act in a dominant negative manner. Infantile spasms were the more prominent type of seizure in EIEE5 associated with SPTAN1 variants and reported to be refractory to treatment1. References: 1. Syrbe S. et al. Delineating SPTAN1 associated phenotypes: From isolated epilepsy to encephalopathy with progressive brain atrophy. Brain 140 2322–2336 (2017). 2. Nonoda Y. et al. Progressive diffuse brain atrophy in West syndrome with marked hypomyelination due to SPTAN1 gene mutation. Brain Dev. 35 280–283 (2013). 3. Tohyama J. et al. SPTAN1 encephalopathy: Distinct phenotypes and genotypes. Journal of Human Genetics 60 167–173 (2015). 4. Saitsu H. et al. Dominant-Negative Mutations in α-II Spectrin Cause West Syndrome with Severe Cerebral Hypomyelination Spastic Quadriplegia and Developmental Delay. Am. J. Hum. Genet. 86 881–891 (2010). 5. den Dunnen J. T. et al. HGVS Recommendations for the Description of Sequence Variants: 2016 Update. Hum. Mutat. 37 564–569 (2016). 6. Richards S. et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 17 405–24 (2015). (less)
click to load more click to collapse
Flagged submissions do not contribute to the aggregate classification or review status for the variant. Learn more

Comment:

Published functional studies suggest this variant has a dominant negative effect on neurons, however additional studies are needed to validate the functional effect of this variant (Wang et al., 2018); In-frame duplication of three amino acids in a non-repeat region; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34440880, 22656320, 29337302, 29050398, 25631096)

Comment:

ClinVar contains an entry for this variant (Variation ID: 160028). This variant has been observed in individual(s) with West syndrome (PMID: 22656320, 29050398). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.6908_6916dup, results in the insertion of 3 amino acid(s) of the SPTAN1 protein (p.Asp2303_Leu2305dup), but otherwise preserves the integrity of the reading frame. Experimental studies have shown that this variant affects SPTAN1 function (PMID: 29050398). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant.

Comment:

A Heterozygous Inframe indel variant c.6881_6882insGGACCAGCT in Exon 52 of the SPTAN1 gene that results in the amino acid substitution p.Trp2294_Asp2295insAspGlnLeu was identified. The observed variant is novel in gnomAD exomes and genomes, respectively. The severity of the impact of this variant on the protein is medium, based on the effect of the protein and REVEL score. Rare Exome Variant Ensemble Learner (REVEL) is an ensembl method for predicting the pathogenicity of missense variants based on a combination of scores from 13 individual tools: MutPred, FATHMM v2.3, VEST 3.0, PolyPhen-2, SIFT, PROVEAN, MutationAssessor, MutationTaster, LRT, GERP++, SiPhy, phyloP, and phastCons. The REVEL score for an individual missense variant can range from 0 to 1, with higher scores reflecting greater likelihood that the variant is disease-causing. ClinVar has also classified this variant as Pathogenic/ LikelyPathogenic (Variant ID: 160028). This disorder has previously been reported in the patient affected with epilepsy (Nonoda Y et.al 2012). Based on the above evidence this variant has been classified as Likely Pathogenic according to the ACMG guidelines.

Comment:

The SPTAN1 c.6908_6916dup9 variant is predicted to result in an in-frame duplication (p.Asp2303_Leu2305dup). This variant has been reported as a recurrent de novo change in multiple unrelated individuals affected with West syndrome with progressive brain atrophy and functional studies suggested that this variant causes aggregation of spectrin complexes in neurons via dominant-negative effects (Nonoda et al. 2013. PubMed ID: 22656320; Tohyama et al. 2015. PubMed ID: 25631096; Syrbe et al. 2017. PubMed ID: 29050398; Wang et al. 2018. PubMed ID: 29337302). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic.

Comment:

The c.6908_6916dupACCAGCTGG pathogenic mutation (also known as p.D2303_L2305dup), located in coding exon 52 of the SPTAN1 gene, results from an in-frame duplication of ACCAGCTGG at nucleotide positions 6908 to 6916. This results in the duplication of 3 extra residues (DQL) between codons 2303 and 2305. This variant has been determined to be the result of a de novo mutation or germline mosaicism in one family with an isolated case of developmental delay, intellectual disability, and microcephaly. This duplication was also reported as a de novo occurrence in a 1-year-old male with West syndrome, hypomyelination of the cerebral white matter, and impaired psychomoter development (Nonoda Y et al. Brain Dev., 2013 Mar;35:280-3). The mutation occurs in the last two spectrin repeats of the SPTAN1 protein, where several in-frame duplications and deletions have been detected in patients with West syndrome (Tohyama J et al. J. Hum. Genet., 2015 Apr;60:167-73). In addition, this alteration is predicted to be deleterious by PROVEAN in silico analysis (Choi Y et al., PLoS ONE 2012; 7(10):e46688). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

Comment:

Variant interpretted as Pathogenic and reported on 08-28-2019 by Lab or GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. GenomeConnect staff make no attempt to reinterpret the clinical significance of the variant.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Critical roles of αII spectrin in brain development and epileptic encephalopathy.	Wang Y	The Journal of clinical investigation	2018	PMID: 29337302
Delineating SPTAN1 associated phenotypes: from isolated epilepsy to encephalopathy with progressive brain atrophy.	Syrbe S	Brain : a journal of neurology	2017	DOI: 10.1093/brain/awx195
Delineating SPTAN1 associated phenotypes: from isolated epilepsy to encephalopathy with progressive brain atrophy.	Syrbe S	Brain : a journal of neurology	2017	PMID: 29050398
SPTAN1 encephalopathy: distinct phenotypes and genotypes.	Tohyama J	Journal of human genetics	2015	PMID: 25631096
Progressive diffuse brain atrophy in West syndrome with marked hypomyelination due to SPTAN1 gene mutation.	Nonoda Y	Brain & development	2013	PMID: 22656320
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=SPTAN1	-	-	-	-

Text-mined citations for rs587784440 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 25, 2024

ClinVar Genomic variation as it relates to human health

NM_001130438.3(SPTAN1):c.6899ACCAGCTGG[3] (p.2300DQL[3])

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs587784440 ...