VCV000555843.18 - ClinVar

NM_033056.4(PCDH15):c.5347_5363del (p.Pro1783fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(6)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Conflicting classifications of pathogenicity
Likely pathogenic(2); Uncertain significance(1); Likely benign(2)

criteria provided, conflicting classifications

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_033056.4(PCDH15):c.5347_5363del (p.Pro1783fs)

Variation ID: 555843 Accession: VCV000555843.18

Type and length

Deletion, 17 bp

Location

Cytogenetic: 10q21.1 10: 53822363-53822379 (GRCh38) [ NCBI UCSC ] 10: 55582123-55582139 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 5, 2018	Oct 26, 2024	Aug 2, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_001384140.1:c.4368-2149_4368-2133del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		intron variant
NM_033056.4:c.5347_5363del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_149045.3:p.Pro1783fs	frameshift
NM_033056.4:c.5347_5363del17 MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001142763.2:c.5368_5384del	NP_001136235.1:p.Pro1790fs	frameshift
NM_001142764.2:c.5353_5369del	NP_001136236.1:p.Pro1785fs	frameshift
NM_001142765.2:c.5140_5156del	NP_001136237.1:p.Pro1714fs	frameshift
NM_001142766.2:c.5338_5354del	NP_001136238.1:p.Pro1780fs	frameshift
NM_001142767.2:c.5227_5243del	NP_001136239.1:p.Pro1743fs	frameshift
NM_001142768.2:c.5287_5303del	NP_001136240.1:p.Pro1763fs	frameshift
NM_001142769.3:c.4409+2757_4409+2773del		intron variant
NM_001142770.3:c.4373+2757_4373+2773del		intron variant
NM_001142771.2:c.4388+2757_4388+2773del		intron variant
NM_001142772.2:c.4373+2757_4373+2773del		intron variant
NM_001142773.2:c.5278_5294del	NP_001136245.1:p.Pro1760fs	frameshift
NM_001354404.2:c.5281_5297del	NP_001341333.1:p.Pro1761fs	frameshift
NM_001354411.2:c.4388+5014_4388+5030del		intron variant
NM_001354420.2:c.4367+5014_4367+5030del		intron variant
NM_001354429.2:c.4368-4366_4368-4350del		intron variant
NM_033056.3:c.5347_5363del
NM_033056.3:c.5347_5363delCCTCCTTCTATCCCTCT
NC_000010.11:g.53822370_53822386del
NC_000010.10:g.55582130_55582146del
NG_009191.3:g.1811804_1811820del

... more HGVS ... less HGVS

Protein change

P1761fs, P1780fs, P1790fs, P1714fs, P1763fs, P1785fs, P1743fs, P1760fs, P1783fs

Other names

Canonical SPDI

NC_000010.11:53822362:AGAGGGATAGAAGGAGGAGAGGGA:AGAGGGA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs748086016 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
PCDH15		-	-	GRCh38 GRCh37	3396	3486

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Usher syndrome type 1F	Conflicting interpretations of pathogenicity (3)	criteria provided, conflicting classifications	Mar 10, 2018	RCV000671747.5
not provided	Conflicting interpretations of pathogenicity (2)	criteria provided, conflicting classifications	Jan 22, 2024	RCV000961061.14
not specified	Likely benign (1)	criteria provided, single submitter	Aug 2, 2024	RCV004768541.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Dec 28, 2017)	criteria provided, single submitter (Counsyl Autosomal Recessive and X-Linked Classification Criteria (2018)) Method: clinical testing	Usher syndrome type 1F Affected status: unknown Allele origin: unknown	Counsyl Accession: SCV000796761.1 First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018
Likely pathogenic (Mar 10, 2018)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Usher Syndrome, type 1F Affected status: no Allele origin: germline	GeneID Lab - Advanced Molecular Diagnostics Accession: SCV000807814.1 First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018	Comment: This variant results in an amino acid alteration replacing a proline (P) with a serine (S) at position 1783 creating a premature stop signal in … (more) This variant results in an amino acid alteration replacing a proline (P) with a serine (S) at position 1783 creating a premature stop signal in the new reading frame noted as p.R80Pfs*69. The substitution is predicted to result in a non-functional PDCH15 protein, either through protein truncation or nonsense-mediated mRNA decay. This mutation is considered a non-tolerated amino acid change based on in silico prediction algorithms (disease causing), and it has not been reported in the ClinVar Database (NCBI National Library of Medicine, NIH, Bethesda MD), but it has been described in 12 alleles out of 50254, in the ExAC database, all of them belonging to heterozygous carries of Latino origin. Based on these findings and the limited literature regarding this substitution we consider it as a likely pathogenic variant. (less) Number of individuals with the variant: 1 Age: 30-39 years Sex: female Ethnicity/Population group: Latin American Geographic origin: United States
Likely pathogenic (Nov 03, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV002021623.3 First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024
Likely benign (Jan 22, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001108090.6 First in ClinVar: Dec 17, 2019 Last updated: Feb 20, 2024
Likely benign (Aug 02, 2024)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	not specified Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV005381580.1 First in ClinVar: Oct 26, 2024 Last updated: Oct 26, 2024	Comment: Variant summary: PCDH15 c.5347_5363del17 (p.Pro1783SerfsX59) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein … (more) Variant summary: PCDH15 c.5347_5363del17 (p.Pro1783SerfsX59) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant allele was found at a frequency of 0.00011 in 189612 control chromosomes in the gnomAD database, including 2 homozygotes. This frequency is not significantly higher than estimated for a pathogenic variant in PCDH15 causing Usher Syndrome Type 1F (0.00011 vs 0.0032), allowing no conclusion about variant significance. To our knowledge, no occurrence of c.5347_5363del17 in individuals affected with Usher Syndrome Type 1F and no experimental evidence demonstrating its impact on protein function have been reported. However, an upstream truncating variant NM_033056.4:c.4831_4834dup (p.Thr1612fs) has been universally classified as Likely Benign/Benign by at least 5 laboratories in ClinVar and has a gnomAD frequency of ~1% in the African/African American subpopulation, including 4 homozygotes. These data suggest the C-terminal region downstream of p.Thr1612 may be dispensable for PCDH15 function. ClinVar contains an entry for this variant (Variation ID: 555843). Based on the evidence outlined above, the variant was classified as likely benign. (less)
Likely benign (Aug 19, 2020)	no assertion criteria provided Method: clinical testing	Usher syndrome type 1F Affected status: unknown Allele origin: germline	Natera, Inc. Accession: SCV002075571.1 First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022

Comment:

This variant results in an amino acid alteration replacing a proline (P) with a serine (S) at position 1783 creating a premature stop signal in the new reading frame noted as p.R80Pfs*69. The substitution is predicted to result in a non-functional PDCH15 protein, either through protein truncation or nonsense-mediated mRNA decay. This mutation is considered a non-tolerated amino acid change based on in silico prediction algorithms (disease causing), and it has not been reported in the ClinVar Database (NCBI National Library of Medicine, NIH, Bethesda MD), but it has been described in 12 alleles out of 50254, in the ExAC database, all of them belonging to heterozygous carries of Latino origin. Based on these findings and the limited literature regarding this substitution we consider it as a likely pathogenic variant.

Comment:

Variant summary: PCDH15 c.5347_5363del17 (p.Pro1783SerfsX59) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant allele was found at a frequency of 0.00011 in 189612 control chromosomes in the gnomAD database, including 2 homozygotes. This frequency is not significantly higher than estimated for a pathogenic variant in PCDH15 causing Usher Syndrome Type 1F (0.00011 vs 0.0032), allowing no conclusion about variant significance. To our knowledge, no occurrence of c.5347_5363del17 in individuals affected with Usher Syndrome Type 1F and no experimental evidence demonstrating its impact on protein function have been reported. However, an upstream truncating variant NM_033056.4:c.4831_4834dup (p.Thr1612fs) has been universally classified as Likely Benign/Benign by at least 5 laboratories in ClinVar and has a gnomAD frequency of ~1% in the African/African American subpopulation, including 4 homozygotes. These data suggest the C-terminal region downstream of p.Thr1612 may be dispensable for PCDH15 function. ClinVar contains an entry for this variant (Variation ID: 555843). Based on the evidence outlined above, the variant was classified as likely benign.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs748086016 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 27, 2024

ClinVar Genomic variation as it relates to human health

NM_033056.4(PCDH15):c.5347_5363del (p.Pro1783fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs748086016 ...