VCV000812900.25 - ClinVar

NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(5)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)

Variation ID: 812900 Accession: VCV000812900.25

Type and length

Deletion, 23 bp

Location

Cytogenetic: 20q11.21 20: 31022403-31022425 (GRCh37) [ NCBI UCSC ] 20: 32434600-32434622 (GRCh38) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 27, 2020	Oct 20, 2024	Jun 10, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_015338.6:c.1900_1922del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_056153.2:p.Glu635fs	frameshift
NM_015338.6:c.1900_1922del23 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001363734.1:c.1717_1739del	NP_001350663.1:p.Glu574fs	frameshift
NC_000020.11:g.32434612_32434634del
NC_000020.10:g.31022415_31022437del
NG_027868.1:g.81269_81291del
LRG_630:g.81269_81291del
LRG_630t1:c.1900_1922del

... more HGVS ... less HGVS

Protein change

E635fs, E574fs

Other names

Canonical SPDI

NC_000020.11:32434599:CACCACTGCCATAGAGAGGCGGCCACCACTGCCAT:CACCACTGCCAT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs766433101 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ASXL1		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	1016	1038

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Cafe-au-lait spot Juvenile myelomonocytic leukemia	Pathogenic (1)	no assertion criteria provided	-	RCV001003812.2
Bohring-Opitz syndrome	Pathogenic/Likely pathogenic (3)	criteria provided, multiple submitters, no conflicts	Jun 10, 2024	RCV001706715.5
not provided	Pathogenic (1)	criteria provided, single submitter	Apr 1, 2023	RCV001726412.20

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Mar 05, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Bohring-Opitz syndrome Affected status: yes Allele origin: de novo	Institute of Human Genetics, University of Leipzig Medical Center Accession: SCV001934469.1 First in ClinVar: Sep 25, 2021 Last updated: Sep 25, 2021	Comment: This variant was identified as de novo (maternity and paternity confirmed).
Likely pathogenic (Mar 29, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Bohring-Opitz syndrome Affected status: unknown Allele origin: germline	Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center Accession: SCV004808274.1 First in ClinVar: Apr 06, 2024 Last updated: Apr 06, 2024
Pathogenic (Jun 10, 2024)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	Bohring-Opitz syndrome Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV005204835.1 First in ClinVar: Sep 16, 2024 Last updated: Sep 16, 2024	Publications: PubMed (20) PubMed: 22489043‚ 24442206‚ 24458439‚ 25652455‚ 24695057‚ 23018865‚ 21881046‚ 23619563‚ 20880116‚ 23690417‚ 22031865‚ 25596267‚ 22058207‚ 24496303‚ 21576631‚ 24255920‚ 27895058‚ 27276561‚ 30013160‚ 32581362 Comment: Variant summary: ASXL1 c.1900_1922del23 (p.Glu635ArgfsX15) results in a premature termination codon, not expected to result in nonsense mediated decay (NMD) but predicted to cause a … (more) Variant summary: ASXL1 c.1900_1922del23 (p.Glu635ArgfsX15) results in a premature termination codon, not expected to result in nonsense mediated decay (NMD) but predicted to cause a truncation of the encoded protein, removing a large part of the protein, including the PHD-type zinc finger domain (amino acids 1500-1539; IPR026905), which is a DNA-binding domain. The frequency data for this variant in gnomAD is considered unreliable, as metrics indicate poor data quality at this position. To our knowledge, the variant, c.1900_1922del23, has not been reported in the literature in individuals affected with Bohring-Opitz Syndrome. However, multiple truncations downstream are reported in affected individuals (HGMD) and are classified as pathogenic for Bohring-Opitz syndrome by our laboratory (and others in ClinVar). ClinVar contains an entry for this variant (Variation ID: 812900). Based on the evidence outlined above, the variant was classified as pathogenic. (less)
Pathogenic (Apr 01, 2023)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV001962380.20 First in ClinVar: Oct 08, 2021 Last updated: Oct 20, 2024	Comment: ASXL1: PVS1:Strong, PM2, PS2:Moderate, PS4:Moderate Number of individuals with the variant: 2
Pathogenic (-)	no assertion criteria provided Method: research	Cafe-au-lait spot Juvenile myelomonocytic leukemia Affected status: yes Allele origin: unknown	NIHR Bioresource Rare Diseases, University of Cambridge Accession: SCV001162262.1 First in ClinVar: Feb 27, 2020 Last updated: Feb 27, 2020	Publications: PubMed (1) PubMed: 32581362 Number of individuals with the variant: 1 Sex: male

Comment:

Variant summary: ASXL1 c.1900_1922del23 (p.Glu635ArgfsX15) results in a premature termination codon, not expected to result in nonsense mediated decay (NMD) but predicted to cause a truncation of the encoded protein, removing a large part of the protein, including the PHD-type zinc finger domain (amino acids 1500-1539; IPR026905), which is a DNA-binding domain. The frequency data for this variant in gnomAD is considered unreliable, as metrics indicate poor data quality at this position. To our knowledge, the variant, c.1900_1922del23, has not been reported in the literature in individuals affected with Bohring-Opitz Syndrome. However, multiple truncations downstream are reported in affected individuals (HGMD) and are classified as pathogenic for Bohring-Opitz syndrome by our laboratory (and others in ClinVar). ClinVar contains an entry for this variant (Variation ID: 812900). Based on the evidence outlined above, the variant was classified as pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Whole-genome sequencing of patients with rare diseases in a national health system.	Turro E	Nature	2020	PMID: 32581362
Mutant ASXL1 cooperates with BAP1 to promote myeloid leukaemogenesis.	Asada S	Nature communications	2018	PMID: 30013160
Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel.	Döhner H	Blood	2017	PMID: 27895058
Genomic Classification and Prognosis in Acute Myeloid Leukemia.	Papaemmanuil E	The New England journal of medicine	2016	PMID: 27276561
Integrated genomic profiling, therapy response, and survival in adult acute myelogenous leukemia.	Parkin B	Clinical cancer research : an official journal of the American Association for Cancer Research	2015	PMID: 25652455
ASXL1 mutations in younger adult patients with acute myeloid leukemia: a study by the German-Austrian Acute Myeloid Leukemia Study Group.	Paschka P	Haematologica	2015	PMID: 25596267
ASXL1 and SETBP1 mutations and their prognostic contribution in chronic myelomonocytic leukemia: a two-center study of 466 patients.	Patnaik MM	Leukemia	2014	PMID: 24695057
CALR and ASXL1 mutations-based molecular prognostication in primary myelofibrosis: an international study of 570 patients.	Tefferi A	Leukemia	2014	PMID: 24496303
Impact of mutational status on outcomes in myelofibrosis patients treated with ruxolitinib in the COMFORT-II study.	Guglielmelli P	Blood	2014	PMID: 24458439
Dynamics of ASXL1 mutation and other associated genetic alterations during disease progression in patients with primary myelodysplastic syndrome.	Chen TC	Blood cancer journal	2014	PMID: 24442206
Loss of Asxl1 leads to myelodysplastic syndrome-like disease in mice.	Wang J	Blood	2014	PMID: 24255920
Prognostic score including gene mutations in chronic myelomonocytic leukemia.	Itzykson R	Journal of clinical oncology : official journal of the American Society of Clinical Oncology	2013	PMID: 23690417
Mutations and prognosis in primary myelofibrosis.	Vannucchi AM	Leukemia	2013	PMID: 23619563
ASXL1 exon 12 mutations are frequent in AML with intermediate risk karyotype and are independently associated with an adverse outcome.	Schnittger S	Leukemia	2013	PMID: 23018865
Mutation analysis of ASXL1, CBL, DNMT3A, IDH1, IDH2, JAK2, MPL, NF1, SF3B1, SUZ12, and TET2 in myeloproliferative neoplasms.	Brecqueville M	Genes, chromosomes & cancer	2012	PMID: 22489043
Acquired mutations in ASXL1 in acute myeloid leukemia: prevalence and prognostic value.	Pratcorona M	Haematologica	2012	PMID: 22058207
ASXL1 mutations identify a high-risk subgroup of older patients with primary cytogenetically normal AML within the ELN Favorable genetic category.	Metzeler KH	Blood	2011	PMID: 22031865
Gene mutation patterns and their prognostic impact in a cohort of 1185 patients with acute myeloid leukemia.	Shen Y	Blood	2011	PMID: 21881046
Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes.	Thol F	Journal of clinical oncology : official journal of the American Society of Clinical Oncology	2011	PMID: 21576631
ASXL1 mutation is associated with poor prognosis and acute transformation in chronic myelomonocytic leukaemia.	Gelsi-Boyer V	British journal of haematology	2010	PMID: 20880116
click to load more click to collapse

Text-mined citations for rs766433101 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs766433101 ...