VCV000024527.25 - ClinVar

NM_033380.3(COL4A5):c.2466ACCACCAGG[1] (p.823PPG[1])

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(5)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_033380.3(COL4A5):c.2466ACCACCAGG[1] (p.823PPG[1])

Variation ID: 24527 Accession: VCV000024527.25

Type and length

Microsatellite, 9 bp

Location

Cytogenetic: Xq22.3 X: 108614979-108614987 (GRCh38) [ NCBI UCSC ] X: 107858209-107858217 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2013	Oct 20, 2024	Jul 16, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_033380.3:c.2466ACCACCAGG[1] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_203699.1:p.823PPG[1]	inframe deletion
NM_000495.5:c.2466ACCACCAGG[1]	NP_000486.1:p.823PPG[1]	inframe deletion
NM_000495.5:c.2475_2483del
NC_000023.11:g.108614981ACCACCAGG[1]
NC_000023.10:g.107858211ACCACCAGG[1]
NG_011977.2:g.180058ACCACCAGG[1]
LRG_232:g.180058ACCACCAGG[1]
LRG_232t1:c.2466ACCACCAGG[1]	LRG_232p1:p.823PPG[1]
LRG_232t2:c.2466ACCACCAGG[1]	LRG_232p2:p.823PPG[1]

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000023.11:108614978:GGACCACCAGGACCACCAGG:GGACCACCAGG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA258693 dbSNP: rs104886356 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
COL4A5		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	2625	2807

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
X-linked Alport syndrome	Likely pathogenic (2)	criteria provided, single submitter	Nov 9, 2021	RCV000021406.8
not provided	Pathogenic/Likely pathogenic (3)	criteria provided, multiple submitters, no conflicts	Jul 16, 2023	RCV000991627.21

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Jun 04, 2019)	criteria provided, single submitter (Athena Diagnostics Criteria) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Athena Diagnostics Accession: SCV001143248.1 First in ClinVar: Jan 19, 2020 Last updated: Jan 19, 2020	Comment: The variant disrupts a glycine residue in the canonical Gly-X-Y repeats of the triple helix domain, which are required for stability and structure of this … (more) The variant disrupts a glycine residue in the canonical Gly-X-Y repeats of the triple helix domain, which are required for stability and structure of this protein. Therefore it is expected to severely affect the function of the protein. Found in at least one symptomatic patient, and not found in general population data. (less)
Pathogenic (Jul 16, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001492692.4 First in ClinVar: Mar 07, 2021 Last updated: Feb 14, 2024	Publications: PubMed (7) PubMed: 10094548‚ 31937884‚ 7695699‚ 8218237‚ 19344236‚ 23720012‚ 27627812 Comment: This variant, c.2475_2483del, results in the deletion of 3 amino acid(s) of the COL4A5 protein (p.Pro826_Gly828del), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.2475_2483del, results in the deletion of 3 amino acid(s) of the COL4A5 protein (p.Pro826_Gly828del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Alport syndrome (PMID: 10094548, 31937884; Invitae). This variant is also known as 822delGPP. ClinVar contains an entry for this variant (Variation ID: 24527). This variant disrupts the triple helix domain of COL4A5. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL4A5, missense variants at these glycine residues are significantly enriched in individuals with disease (PMID: 23720012, 27627812) compared to the general population (ExAC). For these reasons, this variant has been classified as Pathogenic. (less)
Likely pathogenic (Nov 09, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	X-linked Alport syndrome Affected status: unknown Allele origin: unknown	Fulgent Genetics, Fulgent Genetics Accession: SCV002802541.1 First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022
Likely pathogenic (Feb 01, 2023)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV003917814.13 First in ClinVar: Apr 23, 2023 Last updated: Oct 20, 2024	Comment: COL4A5: PM2, PM4, PS4:Moderate, PP4 Number of individuals with the variant: 1
not provided (-)	no classification provided Method: phenotyping only	X-linked Alport syndrome Affected status: unknown Allele origin: unknown	GenomeConnect - Invitae Patient Insights Network Accession: SCV001749788.1 First in ClinVar: Jul 18, 2021 Last updated: Jul 18, 2021	Comment: Variant interpreted as Pathogenic and reported on 11-22-2020 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report … (more) Variant interpreted as Pathogenic and reported on 11-22-2020 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. (less) Clinical Features: Myopia (present) , Sensorineural hearing loss disorder (present) , Abnormal renal physiology (present) Indication for testing: Diagnostic Age: 50-59 years Sex: female Testing laboratory: Invitae Date variant was reported to submitter: 2020-11-22 Testing laboratory interpretation: Pathogenic

Comment:

The variant disrupts a glycine residue in the canonical Gly-X-Y repeats of the triple helix domain, which are required for stability and structure of this protein. Therefore it is expected to severely affect the function of the protein. Found in at least one symptomatic patient, and not found in general population data.

Comment:

This variant, c.2475_2483del, results in the deletion of 3 amino acid(s) of the COL4A5 protein (p.Pro826_Gly828del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Alport syndrome (PMID: 10094548, 31937884; Invitae). This variant is also known as 822delGPP. ClinVar contains an entry for this variant (Variation ID: 24527). This variant disrupts the triple helix domain of COL4A5. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL4A5, missense variants at these glycine residues are significantly enriched in individuals with disease (PMID: 23720012, 27627812) compared to the general population (ExAC). For these reasons, this variant has been classified as Pathogenic.

Comment:

Variant interpreted as Pathogenic and reported on 11-22-2020 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Comprehensive genetic diagnosis of Japanese patients with severe proteinuria.	Nagano C	Scientific reports	2020	PMID: 31937884
X-Linked and Autosomal Recessive Alport Syndrome: Pathogenic Variant Features and Further Genotype-Phenotype Correlations.	Savige J	PloS one	2016	PMID: 27627812
DNA variant databases improve test accuracy and phenotype prediction in Alport syndrome.	International Alport Mutation Consortium	Pediatric nephrology (Berlin, Germany)	2014	PMID: 23720012
Collagen structure and stability.	Shoulders MD	Annual review of biochemistry	2009	PMID: 19344236
Detection of mutations in COL4A5 in patients with Alport syndrome.	Plant KE	Human mutation	1999	PMID: 10094548
Crystal and molecular structure of a collagen-like peptide at 1.9 A resolution.	Bella J	Science (New York, N.Y.)	1994	PMID: 7695699
Characterization of collagen-like peptides containing interruptions in the repeating Gly-X-Y sequence.	Long CG	Biochemistry	1993	PMID: 8218237

Text-mined citations for rs104886356 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_033380.3(COL4A5):c.2466ACCACCAGG[1] (p.823PPG[1])

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs104886356 ...