ClinVar Genomic variation as it relates to human health
NM_001018116.2(CAVIN4):c.721CTGAGACAGTCAGGGGAGAGG[1] (p.234LRQSGER[2])
Germline
Classification
(2)
Conflicting classifications of pathogenicity
Uncertain significance(1); Likely benign(1)
Uncertain significance(1); Likely benign(1)
criteria provided, conflicting classifications
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
CAVIN4 | - | - |
GRCh38 GRCh37 |
96 | 131 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Uncertain significance (1) |
|
- | RCV001293220.9 | |
Likely benign (1) |
|
Jun 21, 2021 | RCV001718943.10 |
Citations for germline classification of this variant
HelpText-mined citations for rs746462546 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Nov 25, 2024