"GeneDx"[submitter] AND "TGM1"[gene] - ClinVar

Search results

Items: 85

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 59932	GRCh38/hg38 14q11.2-21.1(chr14:20000611-38984415)x3	LOC130055392, LOC130055393 +780 more	Copy number gain	See cases	GPathogenic
Select item 1226115	NM_000359.3(TGM1):c.*96GGGGAGTCCAGGGCTCCCGGAG[1]	TGM1	Microsatellite (3 prime UTR variant)	not provided	GBenign
Select item 2579539	NM_000359.3(TGM1):c.2316C>A (p.Ser772Arg)	TGM1 (S772R)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 552621	NM_000359.3(TGM1):c.2290C>T (p.Arg764Cys)	TGM1 (R764C)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GConflicting classifications of pathogenicity
Select item 1306187	NM_000359.3(TGM1):c.2279G>A (p.Arg760Gln)	TGM1 (R760Q)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 39536	NM_000359.3(TGM1):c.2278C>T (p.Arg760Ter)	TGM1 (R760*)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic
Select item 312971	NM_000359.3(TGM1):c.2221G>A (p.Val741Ile)	TGM1 (V741I)	Single nucleotide variant (missense variant)	Inborn genetic diseases +2 more	GUncertain significance
Select item 991481	NM_000359.3(TGM1):c.2185G>A (p.Glu729Lys)	TGM1 (E729K)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 782135	NM_000359.3(TGM1):c.2160C>T (p.Thr720=)	TGM1	Single nucleotide variant (synonymous variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 1459722	NM_000359.3(TGM1):c.2090T>G (p.Leu697Ter)	TGM1 (L697*)	Single nucleotide variant (nonsense)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic
Select item 1267272	NM_000359.3(TGM1):c.2088+72G>A	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1280538	NM_000359.3(TGM1):c.1928-47T>G	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 3342695	NM_000359.3(TGM1):c.1756C>T (p.Gln586Ter)	TGM1 (Q586*)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2506801	NM_000359.3(TGM1):c.1661G>T (p.Arg554Leu)	TGM1 (R554L)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 778737	NM_000359.3(TGM1):c.1645+5C>A	TGM1	Single nucleotide variant (intron variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GBenign
Select item 235714	NM_000359.3(TGM1):c.1559A>G (p.Glu520Gly)	TGM1 (E520G)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +2 more	GConflicting classifications of pathogenicity
Select item 1435036	NM_000359.3(TGM1):c.1552del (p.Val518fs)	TGM1 (V518fs)	Deletion (frameshift variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic
Select item 12496	NM_000359.3(TGM1):c.1552G>A (p.Val518Met)	TGM1 (V518M)	Single nucleotide variant (missense variant)	not specified +2 more	GConflicting classifications of pathogenicity
Select item 1253559	NM_000359.3(TGM1):c.1492-51A>G	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1283712	NM_000359.3(TGM1):c.1491+54C>T	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 817199	NM_000359.3(TGM1):c.1437dup (p.Ile480fs)	TGM1 (I480fs)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 372536	NM_000359.3(TGM1):c.1417G>A (p.Gly473Ser)	TGM1 (G473S)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 420340	NM_000359.3(TGM1):c.1407_1416delinsGCTCTGT (p.Ile469_Cys471delinsMetLeu)	TGM1	Indel (inframe_indel)	not provided	GLikely pathogenic
Select item 1177768	NM_000359.3(TGM1):c.1403-273C>G	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 421103	NM_000359.3(TGM1):c.1303T>C (p.Phe435Leu)	TGM1 (F435L)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 2501363	NM_000359.3(TGM1):c.1267C>A (p.Pro423Thr)	TGM1 (P423T)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1195231	NM_000359.3(TGM1):c.1264A>T (p.Lys422Ter)	TGM1 (K422*)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic
Select item 556069	NM_000359.3(TGM1):c.1261A>G (p.Met421Val)	TGM1 (M421V)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 39537	NM_000359.3(TGM1):c.1223_1227del (p.Asp408fs)	TGM1 (D408fs)	Deletion (frameshift variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic/Likely pathogenic
Select item 12487	NM_000359.3(TGM1):c.1187G>T (p.Arg396Leu)	TGM1 (R396L)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 633787	NM_000359.3(TGM1):c.1186C>T (p.Arg396Cys)	TGM1 (R396C)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +2 more	GPathogenic/Likely pathogenic
Select item 12489	NM_000359.3(TGM1):c.1166G>A (p.Arg389His)	TGM1 (R389H)	Single nucleotide variant (missense variant)	Abnormality of the skin +3 more	GPathogenic/Likely pathogenic
Select item 255941	NM_000359.3(TGM1):c.1146C>A (p.Gly382=)	TGM1	Single nucleotide variant (synonymous variant)	not provided +2 more	GBenign
Select item 12486	NM_000359.3(TGM1):c.1135G>C (p.Val379Leu)	TGM1 (V379L)	Single nucleotide variant (missense variant)	Lamellar ichthyosis +2 more	GPathogenic
Select item 312981	NM_000359.3(TGM1):c.1113C>T (p.Ser371=)	TGM1	Single nucleotide variant (synonymous variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GBenign/Likely benign
Select item 427008	NM_000359.3(TGM1):c.1094A>G (p.Tyr365Cys)	TGM1 (Y365C)	Single nucleotide variant (missense variant)	not provided	GPathogenic
Select item 2428896	NM_000359.3(TGM1):c.1088T>C (p.Leu363Pro)	TGM1 (L363P)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 372535	NM_000359.3(TGM1):c.1082T>C (p.Ile361Thr)	TGM1 (I361T)	Single nucleotide variant (missense variant)	not provided +2 more	GConflicting classifications of pathogenicity
Select item 427175	NM_000359.3(TGM1):c.1055C>T (p.Pro352Leu)	TGM1 (P352L)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 694521	NM_000359.3(TGM1):c.1054C>G (p.Pro352Ala)	TGM1 (P352A)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic
Select item 556205	NM_000359.3(TGM1):c.1042C>T (p.Arg348Ter)	TGM1 (R348*)	Single nucleotide variant (nonsense)	not provided +2 more	GPathogenic
Select item 1711983	NM_000359.3(TGM1):c.1031G>C (p.Gly344Ala)	TGM1 (G344A)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 1189470	NM_000359.3(TGM1):c.1025G>T (p.Trp342Leu)	TGM1 (W342L)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 12484	NM_000359.3(TGM1):c.968G>A (p.Arg323Gln)	TGM1 (R323Q)	Single nucleotide variant (missense variant)	Lamellar ichthyosis +2 more	GPathogenic
Select item 449108	NM_000359.3(TGM1):c.967C>T (p.Arg323Trp)	TGM1 (R323W)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +2 more	GConflicting classifications of pathogenicity
Select item 39531	NM_000359.3(TGM1):c.944G>T (p.Arg315Leu)	TGM1 (R315L)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic/Likely pathogenic
Select item 39530	NM_000359.3(TGM1):c.944G>A (p.Arg315His)	TGM1 (R315H)	Single nucleotide variant (missense variant)	Lamellar ichthyosis +2 more	GPathogenic
Select item 737333	NM_000359.3(TGM1):c.923G>A (p.Arg308Gln)	TGM1 (R308Q)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GConflicting classifications of pathogenicity
Select item 1555661	NM_000359.3(TGM1):c.920G>A (p.Arg307Gln)	TGM1 (R307Q)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GConflicting classifications of pathogenicity
Select item 372534	NM_000359.3(TGM1):c.919C>G (p.Arg307Gly)	TGM1 (R307G)	Single nucleotide variant (missense variant)	Lamellar ichthyosis +2 more	GPathogenic
Select item 817048	NM_000359.3(TGM1):c.882_888del (p.Asp294fs)	TGM1 (D294fs)	Deletion (frameshift variant)	not provided	GPathogenic
Select item 279911	NM_000359.3(TGM1):c.877-2A>G	TGM1	Single nucleotide variant (splice acceptor variant)	Autosomal recessive congenital ichthyosis 1 +2 more	GPathogenic
Select item 372533	NM_000359.3(TGM1):c.876+2T>C	TGM1	Single nucleotide variant (splice donor variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 265269	NM_000359.3(TGM1):c.872G>A (p.Gly291Asp)	TGM1 (G291D)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic
Select item 555662	NM_000359.3(TGM1):c.871G>A (p.Gly291Ser)	TGM1 (G291S)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 12495	NM_000359.3(TGM1):c.857G>A (p.Arg286Gln)	TGM1 (R286Q)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 12492	NM_000359.3(TGM1):c.832G>A (p.Gly278Arg)	TGM1 (G278R)	Single nucleotide variant (missense variant)	not provided +2 more	GPathogenic/Likely pathogenic
Select item 451173	NM_000359.3(TGM1):c.817G>A (p.Gly273Arg)	TGM1 (G273R)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GLikely pathogenic
Select item 556211	NM_000359.3(TGM1):c.802del (p.Val268fs)	TGM1 (V268fs)	Deletion (frameshift variant)	Lamellar ichthyosis +2 more	GPathogenic/Likely pathogenic
Select item 372532	NM_000359.3(TGM1):c.790C>T (p.Arg264Trp)	TGM1 (R264W)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic/Likely pathogenic
Select item 419403	NM_000359.3(TGM1):c.788G>A (p.Trp263Ter)	TGM1 (W263*)	Single nucleotide variant (nonsense)	Lamellar ichthyosis +2 more	GPathogenic
Select item 255942	NM_000359.3(TGM1):c.726G>A (p.Glu242=)	TGM1	Single nucleotide variant (synonymous variant)	not provided +2 more	GBenign
Select item 12500	NM_000359.3(TGM1):c.652G>A (p.Gly218Ser)	TGM1 (G218S)	Single nucleotide variant (missense variant)	Congenital ichthyosiform erythroderma +3 more	GPathogenic/Likely pathogenic
Select item 620502	NM_000359.3(TGM1):c.586C>T (p.Gln196Ter)	TGM1 (Q196*)	Single nucleotide variant (nonsense)	Autosomal recessive congenital ichthyosis 1 +1 more	GPathogenic/Likely pathogenic
Select item 743864	NM_000359.3(TGM1):c.550C>T (p.Pro184Ser)	TGM1 (P184S)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +2 more	GConflicting classifications of pathogenicity
Select item 1230006	NM_000359.3(TGM1):c.509-196T>G	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1263572	NM_000359.3(TGM1):c.508+439T>C	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1187841	NM_000359.3(TGM1):c.450CCT[2] (p.Leu153del)	TGM1 (L153del)	Microsatellite (inframe_deletion)	not provided +1 more	GLikely pathogenic
Select item 452009	NM_000359.3(TGM1):c.427C>G (p.Arg143Gly)	TGM1 (R143G)	Single nucleotide variant (missense variant)	not provided	GPathogenic
Select item 372531	NM_000359.3(TGM1):c.427C>T (p.Arg143Cys)	TGM1 (R143C)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic
Select item 372784	NM_000359.3(TGM1):c.420A>G (p.Ile140Met)	TGM1 (I140M)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 1307378	NM_000359.3(TGM1):c.418A>G (p.Ile140Val)	TGM1 (I140V)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 372530	NM_000359.3(TGM1):c.398_407dup (p.Tyr136Ter)	TGM1 (Y136*)	Duplication (nonsense)	Abnormality of the skin +2 more	GPathogenic
Select item 551268	NM_000359.3(TGM1):c.401A>G (p.Tyr134Cys)	TGM1 (Y134C)	Single nucleotide variant (missense variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 279910	NM_000359.3(TGM1):c.379C>T (p.Arg127Ter)	TGM1 (R127*)	Single nucleotide variant (nonsense)	not provided +2 more	GPathogenic
Select item 279909	NM_000359.3(TGM1):c.377G>A (p.Arg126His)	TGM1 (R126H)	Single nucleotide variant (missense variant)	not provided +2 more	GPathogenic
Select item 1235558	NM_000359.3(TGM1):c.320-41T>A	TGM1	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 12497	NM_000359.3(TGM1):c.281G>A (p.Gly94Asp)	TGM1 (G94D)	Single nucleotide variant (missense variant)	Autosomal recessive congenital ichthyosis 1 +1 more	GConflicting classifications of pathogenicity
Select item 449511	NM_000359.3(TGM1):c.232C>T (p.Arg78Ter)	TGM1 (R78*)	Single nucleotide variant (nonsense)	Autosomal recessive congenital ichthyosis 1 +2 more	GPathogenic
Select item 280810	NM_000359.3(TGM1):c.184G>T (p.Gly62Ter)	TGM1 (G62*)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic
Select item 732193	NM_000359.3(TGM1):c.167C>T (p.Ala56Val)	TGM1 (A56V)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 554786	NM_000359.3(TGM1):c.160C>T (p.Arg54Ter)	TGM1 (R54*)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic
Select item 265597	NM_000359.3(TGM1):c.132G>A (p.Trp44Ter)	TGM1 (W44*)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 12480	NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr)	TGM1 (S42Y)	Single nucleotide variant (missense variant)	not provided +2 more	GConflicting classifications of pathogenicity
Select item 253659	GRCh37/hg19 14q11.2-12(chr14:19794561-27768254)x3	ABHD4, ACIN1 +149 more	Copy number gain	See cases	GPathogenic

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 85