"GeneDx"[submitter] AND "RUNX2"[gene] - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 69

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 58427	GRCh38/hg38 6p21.2-21.1(chr6:37777369-45653843)x1	LOC129996415, LOC129996416 +435 more	Copy number loss	See cases	GPathogenic
Select item 58428	GRCh38/hg38 6p21.1-12.3(chr6:41638061-46512949)x1	LOC132089395, LOC132089396 +324 more	Copy number loss	See cases	GPathogenic
Select item 59500	GRCh38/hg38 6p21.1(chr6:44993452-46061865)x3	CLIC5, LOC109611589 +22 more	Copy number gain	See cases	GUncertain significance
Select item 1196317	NM_001024630.4(RUNX2):c.-66-59A>G	LOC109611593, RUNX2 +1 more	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1207597	NM_001024630.4(RUNX2):c.-66T>C	RUNX2, SUPT3H	Single nucleotide variant (5 prime UTR variant +2 more)	not provided	GLikely benign
Select item 357089	NM_001024630.4(RUNX2):c.-11_-9del	RUNX2, SUPT3H	Deletion (5 prime UTR variant +2 more)	not provided +1 more	GBenign/Likely benign
Select item 1277725	NM_001024630.4(RUNX2):c.58+97T>C	RUNX2, SUPT3H	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1266687	NM_001024630.4(RUNX2):c.59-672T>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1204787	NM_001024630.4(RUNX2):c.59-489G>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1196572	NM_001024630.4(RUNX2):c.59-242G>T	RUNX2	Single nucleotide variant (5 prime UTR variant +1 more)	not provided	GLikely benign
Select item 65626	NM_001024630.4(RUNX2):c.90dup (p.Ser31fs)	RUNX2 (S17fs +1 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 1303448	NM_001024630.4(RUNX2):c.88C>G (p.Pro30Ala)	RUNX2 (P16A +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 196302	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 1329578	NM_001024630.4(RUNX2):c.174_185dup (p.Gln68_Gln71dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 1192123	NM_001024630.4(RUNX2):c.177GCA[7] (p.Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 1132909	NM_001024630.4(RUNX2):c.174A>G (p.Gln58=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 257095	NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not specified +2 more	GBenign/Likely benign
Select item 2430470	NM_001024630.4(RUNX2):c.238G>T (p.Ala80Ser)	LOC109611589, RUNX2 (A66S +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 196301	NM_001024630.4(RUNX2):c.240G>A (p.Ala80=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	Cleidocranial dysostosis +2 more	GBenign
Select item 376847	NM_001024630.4(RUNX2):c.254C>T (p.Ala85Val)	LOC109611589, RUNX2 (A85V +1 more)	Single nucleotide variant (missense variant)	not provided +1 more	GBenign/Likely benign
Select item 1708145	NM_001024630.4(RUNX2):c.360C>A (p.Asn120Lys)	RUNX2 (N106K +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +1 more	GConflicting classifications of pathogenicity
Select item 257096	NM_001024630.4(RUNX2):c.423+39G>C	RUNX2	Single nucleotide variant (intron variant)	not provided +3 more	GBenign/Likely benign
Select item 1276438	NM_001024630.4(RUNX2):c.423+146_423+147dup	RUNX2	Duplication (intron variant)	not provided	GBenign
Select item 1229960	NM_001024630.4(RUNX2):c.423+255G>C	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1246107	NM_001024630.4(RUNX2):c.423+268C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1183268	NM_001024630.4(RUNX2):c.423+279C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 3340830	NM_001024630.4(RUNX2):c.480C>G (p.Asn160Lys)	RUNX2 (N146K +1 more)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 787303	NM_001024630.4(RUNX2):c.549C>T (p.Asn183=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1071563	NM_001024630.4(RUNX2):c.568C>T (p.Arg190Trp)	RUNX2 (R176W +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +3 more	GPathogenic
Select item 381546	NM_001024630.4(RUNX2):c.569G>A (p.Arg190Gln)	RUNX2 (R190Q +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +1 more	GPathogenic/Likely pathogenic
Select item 829868	NM_001024630.4(RUNX2):c.577C>T (p.Arg193Ter)	RUNX2 (R179* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 1271430	NM_001024630.4(RUNX2):c.581-94A>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1683808	NM_001024630.4(RUNX2):c.604del (p.Thr202fs)	RUNX2 (T188fs +1 more)	Deletion (frameshift variant)	not provided	GPathogenic
Select item 2413001	NM_001024630.4(RUNX2):c.625C>T (p.Gln209Ter)	RUNX2 (Q195* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 3371644	NM_001024630.4(RUNX2):c.655G>C (p.Val219Leu)	RUNX2 (V205L +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1702661	NM_001024630.4(RUNX2):c.659C>T (p.Thr220Ile)	RUNX2 (T206I +1 more)	Single nucleotide variant (missense variant)	not provided	GPathogenic
Select item 357092	NM_001024630.4(RUNX2):c.663A>G (p.Val221=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided +1 more	GBenign/Likely benign
Select item 9302	NM_001024630.4(RUNX2):c.674G>A (p.Arg225Gln)	RUNX2 (R225Q +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +2 more	GPathogenic
Select item 1215232	NM_001024630.4(RUNX2):c.686-310_686-309insGT	RUNX2	Insertion (intron variant)	not provided	GLikely benign
Select item 1273266	NM_001024630.4(RUNX2):c.686-264C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 2428800	NM_001024630.4(RUNX2):c.686-7T>G	RUNX2	Single nucleotide variant (intron variant)	not provided	GUncertain significance
Select item 1212891	NM_001024630.4(RUNX2):c.686-1G>A	RUNX2	Single nucleotide variant (splice acceptor variant)	not provided	GLikely pathogenic
Select item 1311105	NM_001024630.4(RUNX2):c.827C>G (p.Pro276Arg)	RUNX2 (P262R +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1207432	NM_001024630.4(RUNX2):c.859+252G>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 59501	GRCh38/hg38 6p21.1(chr6:45507351-46014903)x3	CLIC5, LOC110121112 +12 more	Copy number gain	See cases	GUncertain significance
Select item 1277928	NM_001024630.4(RUNX2):c.860-226T>G	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1204047	NM_001024630.4(RUNX2):c.860-194C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 423547	NM_001024630.4(RUNX2):c.860A>G (p.Asp287Gly)	RUNX2 (D287G +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1312166	NM_001024630.4(RUNX2):c.896A>G (p.Tyr299Cys)	RUNX2 (Y285C +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2662272	NM_001024630.4(RUNX2):c.959C>T (p.Pro320Leu)	RUNX2 (P306L +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1313950	NM_001024630.4(RUNX2):c.992C>G (p.Ala331Gly)	RUNX2 (A317G +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1221421	NM_001024630.4(RUNX2):c.1021+46G>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1192720	NM_001024630.4(RUNX2):c.1021+200C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1226788	NM_001024630.4(RUNX2):c.1022-299G>C	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 2582058	NM_001024630.4(RUNX2):c.1022-3C>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GUncertain significance
Select item 1216343	NM_001024630.4(RUNX2):c.1087+17T>C	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign/Likely benign
Select item 1200315	NM_001024630.4(RUNX2):c.1087+231C>T	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1326783	NM_001024630.4(RUNX2):c.1156C>T (p.Arg386Cys)	RUNX2 (R350C +3 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1170860	NM_001024630.4(RUNX2):c.1166A>G (p.Asn389Ser)	RUNX2 (N353S +3 more)	Single nucleotide variant (missense variant)	not provided	GConflicting classifications of pathogenicity
Select item 1312883	NM_001024630.4(RUNX2):c.1172G>A (p.Arg391Gln)	RUNX2 (R355Q +3 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 423643	NM_001024630.4(RUNX2):c.1275dup (p.Tyr426fs)	RUNX2 (Y390fs +3 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 1700939	NM_001024630.4(RUNX2):c.1378C>G (p.Pro460Ala)	RUNX2 (P424A +3 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1300878	NM_001024630.4(RUNX2):c.1385dup (p.Asp463fs)	RUNX2 (D427fs +3 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 634441	NM_001024630.4(RUNX2):c.1379C>T (p.Pro460Leu)	RUNX2 (P460L +3 more)	Single nucleotide variant (missense variant)	not provided +2 more	GUncertain significance
Select item 1306281	NM_001024630.4(RUNX2):c.1428C>T (p.Thr476=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided	GUncertain significance
Select item 357096	NM_001024630.4(RUNX2):c.1531G>A (p.Gly511Ser)	RUNX2 (G511S +3 more)	Single nucleotide variant (missense variant)	not provided +2 more	GBenign/Likely benign
Select item 2507271	NM_001024630.4(RUNX2):c.1555C>T (p.Arg519Ter)	RUNX2 (R483* +3 more)	Single nucleotide variant (nonsense)	not provided	GUncertain significance
Select item 908382	NM_001024630.4(RUNX2):c.*278G>A	RUNX2	Single nucleotide variant (3 prime UTR variant)	Cleidocranial dysostosis +1 more	GBenign/Likely benign
Select item 3361799	NM_001024630.4(RUNX2):c.526A>C (p.Lys176Gln)	RUNX2 (K162Q +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 69