"GeneDx"[submitter] AND "MESP2"[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 15

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 58580	GRCh38/hg38 15q25.2-26.3(chr15:84169153-101904929)x3	ABHD2, ACAN +611 more	Copy number gain	See cases	GPathogenic
Select item 58582	GRCh38/hg38 15q26.1-26.3(chr15:89679237-101978958)x3	ADAMTS17, ALDH1A3 +422 more	Copy number gain	See cases	GPathogenic
Select item 1224835	NC_000015.10:g.89776082T>C	MESP2	Single nucleotide variant	not provided	GBenign
Select item 1276179	NC_000015.10:g.89776088G>A	MESP2	Single nucleotide variant	not provided	GBenign
Select item 284850	NM_001039958.2(MESP2):c.306C>A (p.His102Gln)	MESP2, LOC130057891 (H102Q)	Single nucleotide variant (missense variant)	not specified +2 more	GConflicting classifications of pathogenicity
Select item 5184	NM_001039958.2(MESP2):c.307G>T (p.Glu103Ter)	LOC130057891, MESP2 (E103*)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 257239	NM_001039958.2(MESP2):c.412G>A (p.Val138Met)	MESP2 (V138M)	Single nucleotide variant (missense variant)	not specified +2 more	GBenign
Select item 281201	NM_001039958.2(MESP2):c.534GGGGCAGGGGCAAGGGCAGGGGCA[1] (p.180QG[9])	MESP2	Microsatellite (inframe_deletion)	not specified +1 more	GBenign
Select item 281200	NM_001039958.2(MESP2):c.552GGGGCA[1] (p.180QG[11])	MESP2	Microsatellite (inframe_deletion)	not specified +2 more	GBenign/Likely benign
Select item 257243	NM_001039958.2(MESP2):c.558G>A (p.Gln186=)	MESP2	Single nucleotide variant (synonymous variant)	not specified +2 more	GBenign
Select item 257247	NM_001039958.2(MESP2):c.671C>T (p.Ser224Phe)	MESP2 (S224F)	Single nucleotide variant (missense variant)	Spondylocostal dysostosis 2, autosomal recessive +2 more	GBenign
Select item 552988	NM_001039958.2(MESP2):c.921C>G (p.Tyr307Ter)	MESP2 (Y307*)	Single nucleotide variant (nonsense)	Spondylocostal dysostosis 2, autosomal recessive +1 more	GUncertain significance
Select item 1178600	NM_001039958.2(MESP2):c.925-257A>G	MESP2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1290114	NM_001039958.2(MESP2):c.925-196G>T	MESP2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 253516	GRCh37/hg19 15q22.31-26.3(chr15:64637227-102509910)x3	AAGAB, ABHD17C +278 more	Copy number gain	See cases	GPathogenic