"GeneDx"[submitter] AND "ELN-AS1"[gene] - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 50

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 60237	GRCh38/hg38 7q11.22-11.23(chr7:69382353-77823832)x1	SPDYE12, SPDYE13 +330 more	Copy number loss	See cases	GPathogenic
Select item 60244	GRCh38/hg38 7q11.23-21.11(chr7:73873420-83988860)x1	APTR, CACNA2D1 +249 more	Copy number loss	See cases	GPathogenic
Select item 59712	GRCh38/hg38 7q11.23(chr7:74035454-74133404)x3	LOC129998616, ELN +7 more	Copy number gain	See cases	GPathogenic
Select item 163393	NM_000501.4(ELN):c.1415-9A>G	ELN, ELN-AS1 (N475S)	Single nucleotide variant (missense variant +1 more)	not specified	GConflicting classifications of pathogenicity
Select item 2579635	NM_000501.4(ELN):c.1431dup (p.Gly478fs)	ELN, ELN-AS1 (G389fs +11 more)	Duplication (non-coding transcript variant +1 more)	not provided	GPathogenic
Select item 1178166	NM_000501.4(ELN):c.1453_1488del (p.479VAPGVG[1])	ELN, ELN-AS1	Deletion (inframe_deletion)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 1217528	NM_000501.4(ELN):c.1464_1517del (p.Leu497_Gly514del)	ELN, ELN-AS1	Deletion (inframe_deletion)	not provided +1 more	GBenign/Likely benign
Select item 3371173	NM_000501.4(ELN):c.1468G>A (p.Gly490Ser)	ELN, ELN-AS1 (G401S +11 more)	Single nucleotide variant (non-coding transcript variant +1 more)	not provided	GUncertain significance
Select item 2581829	NM_000501.4(ELN):c.1471G>A (p.Val491Met)	ELN, ELN-AS1 (V402M +11 more)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1313669	NM_000501.4(ELN):c.1488_1523del (p.Leu497_Gly508del)	ELN, ELN-AS1	Deletion (inframe_deletion)	Supravalvar aortic stenosis +1 more	GUncertain significance
Select item 942072	NM_000501.4(ELN):c.1515_1550del (p.501VGVAPG[1])	ELN, ELN-AS1	Deletion (inframe_deletion)	Supravalvar aortic stenosis +1 more	GUncertain significance
Select item 1211190	NM_000501.4(ELN):c.1506C>T (p.Gly502=)	ELN, ELN-AS1	Single nucleotide variant (synonymous variant)	Supravalvar aortic stenosis +1 more	GLikely benign
Select item 360656	NM_000501.4(ELN):c.1507G>A (p.Val503Met)	ELN, ELN-AS1 (V503M +11 more)	Single nucleotide variant (missense variant)	not specified +3 more	GBenign/Likely benign
Select item 2310922	NM_000501.4(ELN):c.1517G>T (p.Gly506Val)	ELN, ELN-AS1 (G496V +11 more)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 1700362	NM_000501.4(ELN):c.1523G>A (p.Gly508Asp)	ELN, ELN-AS1 (G419D +11 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 423742	NM_000501.4(ELN):c.1537G>A (p.Val513Ile)	ELN, ELN-AS1 (V513I +11 more)	Single nucleotide variant (missense variant)	not provided +3 more	GConflicting classifications of pathogenicity
Select item 2008904	NM_000501.4(ELN):c.1539del (p.Gly514fs)	ELN, ELN-AS1 (G425fs +11 more)	Deletion (frameshift variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 1008316	NM_000501.4(ELN):c.1543G>A (p.Val515Met)	ELN, ELN-AS1 (V426M +11 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases +4 more	GUncertain significance
Select item 1186753	NM_000501.4(ELN):c.1576+37G>A	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1327646	NM_000501.4(ELN):c.1577-2A>T	ELN, ELN-AS1	Single nucleotide variant (splice acceptor variant +1 more)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 514200	NM_000501.4(ELN):c.1590C>T (p.Ser530=)	ELN, ELN-AS1	Single nucleotide variant (synonymous variant +1 more)	Supravalvar aortic stenosis +1 more	GLikely benign
Select item 213198	NM_000501.4(ELN):c.1591_1592delinsTT (p.Ala531Phe)	ELN, ELN-AS1 (A442F +10 more)	Indel (missense variant +1 more)	Cutis laxa, autosomal dominant 1 +3 more	GUncertain significance
Select item 667232	NM_000501.4(ELN):c.1606G>T (p.Ala536Ser)	ELN, ELN-AS1 (A447S +10 more)	Single nucleotide variant (missense variant +1 more)	Cutis laxa, autosomal dominant 1 +3 more	GUncertain significance
Select item 16723	NM_000501.4(ELN):c.1621C>T (p.Arg541Ter)	ELN, ELN-AS1 (R570* +10 more)	Single nucleotide variant (nonsense +1 more)	not provided +2 more	GPathogenic
Select item 849541	NM_000501.4(ELN):c.1621+1G>A	ELN, ELN-AS1	Single nucleotide variant (splice donor variant +1 more)	Familial thoracic aortic aneurysm and aortic dissection +2 more	GConflicting classifications of pathogenicity
Select item 679060	NM_000501.4(ELN):c.1622-14C>T	ELN, ELN-AS1	Single nucleotide variant (intron variant)	Supravalvar aortic stenosis +1 more	GConflicting classifications of pathogenicity
Select item 383752	NM_000501.4(ELN):c.1671C>T (p.Val557=)	ELN, ELN-AS1	Single nucleotide variant (synonymous variant)	Supravalvar aortic stenosis +2 more	GLikely benign
Select item 1310675	NM_000501.4(ELN):c.1683ACTTGGAGTTGGTGCTGGTGTTCCTGG[3] (p.562LGVGAGVPG[3])	ELN, ELN-AS1	Microsatellite (inframe_insertion)	not provided +1 more	GUncertain significance
Select item 1204214	NM_000501.4(ELN):c.1683ACTTGGAGTTGGTGCTGGTGTTCCTGG[1] (p.562LGVGAGVPG[1])	ELN, ELN-AS1	Microsatellite (inframe_deletion)	Supravalvar aortic stenosis +1 more	GConflicting classifications of pathogenicity
Select item 1113397	NM_000501.4(ELN):c.1697C>T (p.Ala566Val)	ELN, ELN-AS1 (A477V +11 more)	Single nucleotide variant (missense variant)	Supravalvar aortic stenosis +2 more	GConflicting classifications of pathogenicity
Select item 503920	NM_000501.4(ELN):c.1716dup (p.Val573fs)	ELN, ELN-AS1 (V573fs +11 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 515815	NM_000501.4(ELN):c.1734T>C (p.Pro578=)	ELN, ELN-AS1	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 2074756	NM_000501.4(ELN):c.1741G>A (p.Gly581Arg)	ELN, ELN-AS1 (G492R +11 more)	Single nucleotide variant (missense variant)	Supravalvar aortic stenosis +1 more	GConflicting classifications of pathogenicity
Select item 1197278	NM_000501.4(ELN):c.1741_1742delinsCA (p.Gly581Gln)	ELN, ELN-AS1 (G492Q +11 more)	Indel (missense variant)	not provided	GPathogenic
Select item 1214823	NM_000501.4(ELN):c.1742G>A (p.Gly581Glu)	ELN, ELN-AS1 (G492E +11 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1710780	NM_000501.4(ELN):c.1747+36G>A	ELN-AS1, ELN (E624K)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 3252406	NM_000501.4(ELN):c.1747+69C>T	ELN-AS1, ELN (H635Y)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1002122	NM_000501.4(ELN):c.1747+81A>G	ELN, ELN-AS1 (T639A)	Single nucleotide variant (missense variant +1 more)	not provided +1 more	GUncertain significance
Select item 508761	NM_000501.4(ELN):c.1747+82C>A	ELN, ELN-AS1 (T639N)	Single nucleotide variant (missense variant +1 more)	not provided +1 more	GBenign/Likely benign
Select item 696586	NM_000501.4(ELN):c.1747+83C>T	ELN, ELN-AS1	Single nucleotide variant (synonymous variant +1 more)	Supravalvar aortic stenosis +1 more	GBenign/Likely benign
Select item 517087	NM_000501.4(ELN):c.1747+92A>C	ELN-AS1, ELN	Single nucleotide variant (synonymous variant +1 more)	Supravalvar aortic stenosis +1 more	GLikely benign
Select item 1314459	NM_000501.4(ELN):c.1747+93C>A	ELN, ELN-AS1 (P643T)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 680362	NM_000501.4(ELN):c.1747+109A>G	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided +1 more	GLikely benign
Select item 1198723	NM_000501.4(ELN):c.1747+154C>T	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1178490	NM_000501.4(ELN):c.1747+277G>A	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 453324	NM_000501.4(ELN):c.1767C>T (p.Ala589=)	ELN, ELN-AS1	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 1050457	NM_000501.4(ELN):c.1768G>A (p.Ala590Thr)	ELN, ELN-AS1 (A501T +11 more)	Single nucleotide variant (missense variant)	Supravalvar aortic stenosis +1 more	GUncertain significance
Select item 452771	NM_000501.4(ELN):c.1781A>C (p.Lys594Thr)	ELN-AS1, ELN (K594T +11 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1215941	NM_000501.4(ELN):c.1786+98C>T	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 683509	NM_000501.4(ELN):c.1786+306G>A	ELN, ELN-AS1	Single nucleotide variant (intron variant)	not provided	GBenign

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 50