"GeneDx"[submitter] AND "ELANE"[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 145

<< First< Prev

Page of 2

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 59080	GRCh38/hg38 19p13.3(chr19:591812-1358152)x3	ABCA7, ARHGAP45 +168 more	Copy number gain	See cases	GPathogenic
Select item 60231	GRCh38/hg38 19p13.3(chr19:677680-899104)x3	AZU1, CFD +25 more	Copy number gain	See cases	GUncertain significance
Select item 145089	GRCh38/hg38 19p13.3(chr19:839492-995558)x1	ARID3A, CFD +27 more	Copy number loss	See cases	GPathogenic
Select item 667820	NM_001972.2(ELANE):c.-353G>A	ELANE	Single nucleotide variant	not provided	GBenign
Select item 1278686	NC_000019.10:g.852033T>C	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1274055	NC_000019.10:g.852044C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 677093	NM_001972.2(ELANE):c.-225C>A	ELANE	Single nucleotide variant	not provided	GBenign
Select item 678420	NM_001972.2(ELANE):c.-162C>T	ELANE	Single nucleotide variant	not provided	GLikely benign
Select item 1250740	NC_000019.10:g.852196C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1255032	NC_000019.10:g.852205C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1241499	NC_000019.10:g.852234C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1243625	NC_000019.10:g.852238C>G	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1297304	NC_000019.10:g.852285G>C	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1268417	NC_000019.10:g.852287G>A	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 1236936	NC_000019.10:g.852288C>T	ELANE	Single nucleotide variant (genic upstream transcript variant)	not provided	GBenign
Select item 137203	NM_001972.3(ELANE):c.-41C>A	ELANE	Single nucleotide variant	not provided +3 more	GBenign
Select item 1297299	NM_001972.4(ELANE):c.-11C>T	ELANE	Single nucleotide variant (5 prime UTR variant)	not provided	GBenign
Select item 467829	NM_001972.4(ELANE):c.16C>A (p.Arg6=)	ELANE	Single nucleotide variant (synonymous variant)	not provided +3 more	GBenign/Likely benign
Select item 435054	NM_001972.4(ELANE):c.21C>T (p.Leu7=)	ELANE	Single nucleotide variant (synonymous variant)	not specified +3 more	GBenign/Likely benign
Select item 242275	NM_001972.4(ELANE):c.22G>A (p.Ala8Thr)	ELANE (A8T)	Single nucleotide variant (missense variant)	not provided +2 more	GUncertain significance
Select item 242276	NM_001972.4(ELANE):c.23C>T (p.Ala8Val)	ELANE (A8V)	Single nucleotide variant (missense variant)	not provided +2 more	GUncertain significance
Select item 508375	NM_001972.4(ELANE):c.36C>A (p.Leu12=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +2 more	GLikely benign
Select item 245741	NM_001972.4(ELANE):c.60G>A (p.Leu20=)	ELANE	Single nucleotide variant (synonymous variant)	not specified	GBenign
Select item 1251698	NM_001972.4(ELANE):c.63G>T (p.Leu21=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +2 more	GBenign/Likely benign
Select item 265117	NM_001972.4(ELANE):c.67+1del	ELANE	Deletion (splice donor variant)	not provided	GUncertain significance
Select item 1298045	NM_001972.4(ELANE):c.67+199A>G	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297175	NM_001972.4(ELANE):c.67+210dup	ELANE	Duplication (intron variant)	not provided	GBenign
Select item 1298049	NM_001972.4(ELANE):c.67+209_67+210del	ELANE	Deletion (intron variant)	not provided	GBenign
Select item 1298047	NM_001972.4(ELANE):c.67+210del	ELANE	Deletion (intron variant)	not provided	GBenign
Select item 1213062	NM_001972.4(ELANE):c.68-145GATCCCGTGGGTTCCCGGTGGGG[3]	ELANE	Microsatellite (intron variant)	not provided	GLikely benign
Select item 670422	NM_001972.4(ELANE):c.68-107_68-85del	ELANE	Microsatellite (intron variant)	not provided	GBenign
Select item 1251657	NM_001972.4(ELANE):c.68-129G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1237692	NM_001972.4(ELANE):c.68-106G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1248872	NM_001972.4(ELANE):c.68-84T>C	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1244597	NM_001972.4(ELANE):c.68-79G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1250601	NM_001972.4(ELANE):c.68-64C>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297318	NM_001972.4(ELANE):c.68-61T>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297310	NM_001972.4(ELANE):c.68-19G>A	ELANE	Single nucleotide variant (intron variant)	not provided +2 more	GBenign/Likely benign
Select item 1268942	NM_001972.4(ELANE):c.68-15C>A	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +2 more	GBenign
Select item 511638	NM_001972.4(ELANE):c.68-13G>A	ELANE	Single nucleotide variant (intron variant)	not specified +3 more	GConflicting classifications of pathogenicity
Select item 242277	NM_001972.4(ELANE):c.77T>C (p.Leu26Pro)	ELANE (L26P)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 258502	NM_001972.4(ELANE):c.99C>T (p.Gly33=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +4 more	GBenign/Likely benign
Select item 1147536	NM_001972.4(ELANE):c.102G>A (p.Arg34=)	ELANE	Single nucleotide variant (synonymous variant)	not provided +2 more	GLikely benign
Select item 137198	NM_001972.4(ELANE):c.126C>T (p.Pro42=)	ELANE	Single nucleotide variant (synonymous variant)	not specified	GBenign
Select item 372362	NM_001972.4(ELANE):c.137C>T (p.Ser46Phe)	ELANE (S46F)	Single nucleotide variant (missense variant)	not provided +2 more	GPathogenic
Select item 242295	NM_001972.4(ELANE):c.137C>A (p.Ser46Tyr)	ELANE (S46Y)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 242289	NM_001972.4(ELANE):c.140T>C (p.Leu47Pro)	ELANE (L47P)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +2 more	GPathogenic
Select item 430280	NM_001972.4(ELANE):c.157C>T (p.His53Tyr)	ELANE (H53Y)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 258497	NM_001972.4(ELANE):c.171C>T (p.Ala57=)	ELANE	Single nucleotide variant (synonymous variant)	not specified +2 more	GBenign/Likely benign
Select item 467830	NM_001972.4(ELANE):c.174C>T (p.Thr58=)	ELANE	Single nucleotide variant (synonymous variant)	not provided +3 more	GBenign/Likely benign
Select item 453210	NM_001972.4(ELANE):c.176T>G (p.Leu59Arg)	ELANE (L59R)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 1080173	NM_001972.4(ELANE):c.201G>T (p.Ser67=)	ELANE	Single nucleotide variant (synonymous variant)	not provided +2 more	GBenign/Likely benign
Select item 1233974	NM_001972.4(ELANE):c.204C>T (p.Ala68=)	ELANE	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 242278	NM_001972.4(ELANE):c.212G>T (p.Cys71Phe)	ELANE (C71F)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +1 more	GPathogenic/Likely pathogenic
Select item 242290	NM_001972.4(ELANE):c.217G>A (p.Ala73Thr)	ELANE (A73T)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +4 more	GConflicting classifications of pathogenicity
Select item 1297444	NM_001972.4(ELANE):c.224+31C>G	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1266058	NM_001972.4(ELANE):c.224+99del	ELANE	Deletion (intron variant)	not provided	GBenign
Select item 1250092	NM_001972.4(ELANE):c.225-66G>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1686767	NM_001972.4(ELANE):c.228C>A (p.Asn76Lys)	ELANE (N76K)	Single nucleotide variant (missense variant)	not provided +2 more	GUncertain significance
Select item 618080	NM_001972.4(ELANE):c.235G>T (p.Ala79Ser)	ELANE (A79S)	Single nucleotide variant (missense variant)	Cyclical neutropenia +2 more	GUncertain significance
Select item 430341	NM_001972.4(ELANE):c.241C>T (p.Arg81Trp)	ELANE (R81W)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 418179	NM_001972.4(ELANE):c.251T>C (p.Leu84Pro)	ELANE (L84P)	Single nucleotide variant (missense variant)	ELANE-related disorder +3 more	GPathogenic/Likely pathogenic
Select item 242303	NM_001972.4(ELANE):c.258_269dup (p.His87_Ser90dup)	ELANE	Duplication (inframe_insertion)	not provided +2 more	GConflicting classifications of pathogenicity
Select item 426440	NM_001972.4(ELANE):c.265C>T (p.Leu89Phe)	ELANE (L89F)	Single nucleotide variant (missense variant)	Cyclical neutropenia +2 more	GUncertain significance
Select item 514379	NM_001972.4(ELANE):c.268T>C (p.Ser90Pro)	ELANE (S90P)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 242279	NM_001972.4(ELANE):c.275G>A (p.Arg92Gln)	ELANE (R92Q)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +3 more	GUncertain significance
Select item 1011778	NM_001972.4(ELANE):c.286C>T (p.Arg96Trp)	ELANE (R96W)	Single nucleotide variant (missense variant)	Cyclical neutropenia +2 more	GUncertain significance
Select item 426627	NM_001972.4(ELANE):c.290A>C (p.Gln97Pro)	ELANE (Q97P)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 1266501	NM_001972.4(ELANE):c.303G>A (p.Val101=)	ELANE	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 432094	NM_001972.4(ELANE):c.305A>C (p.Gln102Pro)	ELANE (Q102P)	Single nucleotide variant (missense variant)	not provided	GLikely pathogenic
Select item 418178	NM_001972.4(ELANE):c.308G>T (p.Arg103Leu)	ELANE (R103L)	Single nucleotide variant (missense variant)	ELANE-related disorder +1 more	GLikely pathogenic
Select item 3340776	NM_001972.4(ELANE):c.333del (p.Pro111_Val112insTer)	ELANE	Deletion (frameshift variant +1 more)	not provided	GUncertain significance
Select item 636937	NM_001972.4(ELANE):c.333C>G (p.Pro111=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +2 more	GConflicting classifications of pathogenicity
Select item 242297	NM_001972.4(ELANE):c.336_359del (p.Asn113_Ile120del)	ELANE	Deletion (inframe_deletion)	not provided	GPathogenic
Select item 429670	NM_001972.4(ELANE):c.358A>T (p.Ile120Phe)	ELANE (I120F)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 565626	NM_001972.4(ELANE):c.364C>T (p.Gln122Ter)	ELANE (Q122*)	Single nucleotide variant (nonsense)	not provided +2 more	GConflicting classifications of pathogenicity
Select item 1243004	NM_001972.4(ELANE):c.366+10G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297446	NM_001972.4(ELANE):c.366+12C>A	ELANE	Single nucleotide variant (intron variant)	Cyclical neutropenia +3 more	GBenign/Likely benign
Select item 1229683	NM_001972.4(ELANE):c.366+32C>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1297443	NM_001972.4(ELANE):c.366+66G>C	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1261696	NM_001972.4(ELANE):c.366+125G>A	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1259228	NM_001972.4(ELANE):c.366+135C>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 677257	NM_001972.4(ELANE):c.366+192G>T	ELANE	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1200791	NM_001972.4(ELANE):c.366+299G>T	ELANE	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1181645	NM_001972.4(ELANE):c.367-160C>T	ELANE	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 511663	NM_001972.4(ELANE):c.367-16G>A	ELANE	Single nucleotide variant (intron variant)	not specified	GLikely benign
Select item 1107550	NM_001972.4(ELANE):c.367-8C>T	ELANE	Single nucleotide variant (intron variant)	not provided +2 more	GBenign/Likely benign
Select item 699385	NM_001972.4(ELANE):c.372C>T (p.Asn124=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +2 more	GBenign/Likely benign
Select item 258498	NM_001972.4(ELANE):c.390C>T (p.Asn130=)	ELANE	Single nucleotide variant (synonymous variant)	Neutropenia, severe congenital, 1, autosomal dominant +4 more	GBenign
Select item 242280	NM_001972.4(ELANE):c.407C>T (p.Ala136Val)	ELANE (A136V)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +2 more	GUncertain significance
Select item 16743	NM_001972.4(ELANE):c.416C>T (p.Pro139Leu)	ELANE (P139L)	Single nucleotide variant (missense variant)	Cyclical neutropenia +2 more	GPathogenic/Likely pathogenic
Select item 242291	NM_001972.4(ELANE):c.427C>T (p.Arg143Cys)	ELANE (R143C)	Single nucleotide variant (missense variant)	not provided +3 more	GConflicting classifications of pathogenicity
Select item 515631	NM_001972.4(ELANE):c.428G>A (p.Arg143His)	ELANE (R143H)	Single nucleotide variant (missense variant)	Cyclical neutropenia +4 more	GConflicting classifications of pathogenicity
Select item 242281	NM_001972.4(ELANE):c.431G>A (p.Arg144His)	ELANE (R144H)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +2 more	GUncertain significance
Select item 242282	NM_001972.4(ELANE):c.437G>A (p.Gly146Asp)	ELANE (G146D)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 242283	NM_001972.4(ELANE):c.442G>A (p.Gly148Arg)	ELANE (G148R)	Single nucleotide variant (missense variant)	Neutropenia, severe congenital, 1, autosomal dominant +3 more	GUncertain significance
Select item 242284	NM_001972.4(ELANE):c.452G>T (p.Cys151Phe)	ELANE (C151F)	Single nucleotide variant (missense variant)	not provided	GPathogenic
Select item 418180	NM_001972.4(ELANE):c.456G>A (p.Leu152=)	ELANE	Single nucleotide variant (synonymous variant)	Cyclical neutropenia +3 more	GConflicting classifications of pathogenicity
Select item 430324	NM_001972.4(ELANE):c.472C>G (p.Leu158Val)	ELANE (L158V)	Single nucleotide variant (missense variant)	not provided +3 more	GConflicting classifications of pathogenicity
Select item 449746	NM_001972.4(ELANE):c.490G>C (p.Gly164Arg)	ELANE (G164R)	Single nucleotide variant (missense variant)	Cyclical neutropenia +3 more	GConflicting classifications of pathogenicity

<< First< Prev

Page of 2