ClinVar Genomic variation as it relates to human health
NM_007059.4(KPTN):c.714_731dup (p.Gln246_Asp247insMetTrpSerValLeuGln)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_007059.4(KPTN):c.714_731dup (p.Gln246_Asp247insMetTrpSerValLeuGln)
Variation ID: 100680 Accession: VCV000100680.47
- Type and length
-
Duplication, 18 bp
- Location
-
Cytogenetic: 19q13.32 19: 47479918-47479919 (GRCh38) [ NCBI UCSC ] 19: 47983175-47983176 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 9, 2015 Nov 17, 2024 Jul 17, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_007059.4:c.714_731dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_008990.2:p.Gln246_Asp247insMetTrpSerValLeuGln inframe insertion NM_001291296.2:c.546_563dup NP_001278225.1:p.Gln190_Asp191insMetTrpSerValLeuGln inframe insertion NM_007059.2:c.714_731dupTCTGCAGATGTGGTCGGT NR_111923.2:n.860_877dup non-coding transcript variant NC_000019.10:g.47479922_47479939dup NC_000019.9:g.47983179_47983196dup NG_034097.1:g.9329_9346dup - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000019.10:47479918:ACCGACCACATCTGCAGAACC:ACCGACCACATCTGCAGAACCGACCACATCTGCAGAACC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
KPTN | - | - |
GRCh38 GRCh37 |
160 | 180 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic/Likely pathogenic (6) |
criteria provided, multiple submitters, no conflicts
|
Jul 17, 2023 | RCV000087080.22 | |
Pathogenic/Likely pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
May 3, 2022 | RCV000515002.35 | |
Pathogenic (1) |
criteria provided, single submitter
|
Jul 10, 2023 | RCV003343637.2 | |
KPTN-related disorder
|
Pathogenic (1) |
no assertion criteria provided
|
Jul 16, 2024 | RCV003415870.5 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(May 21, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Genetic Services Laboratory, University of Chicago
Accession: SCV002066295.1
First in ClinVar: Jan 29, 2022 Last updated: Jan 29, 2022 |
|
|
Pathogenic
(May 04, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Macrocephaly-developmental delay syndrome
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001208047.3
First in ClinVar: Apr 15, 2020 Last updated: Feb 07, 2023 |
Comment:
This variant, c.714_731dup, results in the insertion of 6 amino acid(s) of the KPTN protein (p.Met241_Gln246dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.714_731dup, results in the insertion of 6 amino acid(s) of the KPTN protein (p.Met241_Gln246dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs763764442, gnomAD 0.1%), and has an allele count higher than expected for a pathogenic variant. This variant has been observed in individual(s) with macrocephaly, neurodevelopmental delay and seizures (PMID: 24239382). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 100680). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects KPTN function (PMID: 24239382). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Jul 10, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV004058227.2
First in ClinVar: Oct 28, 2023 Last updated: May 01, 2024 |
Comment:
The c.714_731dup18 (p.M241_Q246dup) alteration, located in coding exon 8 of the KPTN gene, results from an in-frame duplication of 18 nucleotides at_x000D_ positions 714 to … (more)
The c.714_731dup18 (p.M241_Q246dup) alteration, located in coding exon 8 of the KPTN gene, results from an in-frame duplication of 18 nucleotides at_x000D_ positions 714 to 731. This results in the duplication of 6 amino acids from codons 241 to 246. Based on data from gnomAD, this allele has an overall frequency of 0.048% (135/279060) total alleles studied. The highest observed frequency was 0.101% (25/24646) of European (Finnish) alleles. This alteration was reported in trans with a second KPTN alteration in multiple individuals with features consistent with KPTN-related neurodevelopmental disorder (Baple, 2014; Thiffault, 2019; Thiffault, 2020). Functional analysis demonstrated that the p.M241_Q246dup alteration led to a mislocalized kaptin protein (Baple, 2014). This alteration is predicted to be deleterious by in silico analysis (Choi, 2012). Based on the available evidence, this alteration is classified as pathogenic. (less)
|
|
Pathogenic
(Mar 29, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Macrocephaly-developmental delay syndrome
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Pittsburgh Clinical Genomics Laboratory, University of Pittsburgh Medical Center
Accession: SCV005397445.1
First in ClinVar: Nov 17, 2024 Last updated: Nov 17, 2024 |
Comment:
This sequence variant is an eighteen nucleotide duplication (dupACCGACCACATCTGCAGA) that results in the inframe insertion of 6 amino acids in exon 8 of 12 of … (more)
This sequence variant is an eighteen nucleotide duplication (dupACCGACCACATCTGCAGA) that results in the inframe insertion of 6 amino acids in exon 8 of 12 of the KPTN gene. This previously reported variant (ClinVar) has been observed in individuals affected by macrocephaly, neurodevelopmental delay and seizures when in the compound heterozygous state (PMID: 32358097). In addition, this variant, when in the compound heterozygous state, co-segregates with this disorder across multiple Ohio Amish families (PMID: 24239382). This variant is rare in control population datasets (gnomAD database, 135 of 279,060 alleles, 0.05%). Routine bioinformatic tools cannot predict the impact this variant will have on the function of kaptin, KPTN's encoded protein. However, protein folding models suggest that this duplication will disrupt the tertiary structure of kaptin (PMID: 24239382), and a functiol study indicates that the protein created by this variant fails to properly localize in neurons (PMID: 24239382). Given this information, we consider this a pathogenic variant. ACMG Criteria: PM3, PM4, PP1, PS3 (less)
|
|
Pathogenic
(May 04, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: not provided
Allele origin:
germline
|
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics
Accession: SCV000611060.1
First in ClinVar: Nov 06, 2017 Last updated: Nov 06, 2017 |
|
|
Likely pathogenic
(Jun 02, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Macrocephaly-developmental delay syndrome
Affected status: yes
Allele origin:
germline
|
Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn
Accession: SCV002577380.1
First in ClinVar: Oct 08, 2022 Last updated: Oct 08, 2022 |
|
|
Pathogenic
(May 03, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000709882.4
First in ClinVar: Apr 02, 2018 Last updated: Mar 04, 2023 |
Comment:
Published functional studies demonstrate a damaging effect resulting in improper localization of the kaptin protein (Baple et al., 2014); In-frame insertion of 6 amino acids … (more)
Published functional studies demonstrate a damaging effect resulting in improper localization of the kaptin protein (Baple et al., 2014); In-frame insertion of 6 amino acids in a non-repeat region; This variant is associated with the following publications: (PMID: 31999056, 24239382, 30008475, 32358097) (less)
|
|
Pathogenic
(Aug 25, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Macrocephaly-developmental delay syndrome
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002803419.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
Pathogenic
(Jul 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Macrocephaly-developmental delay syndrome
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
germline
|
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV002768939.2
First in ClinVar: Dec 24, 2022 Last updated: Jul 23, 2024 |
Comment:
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism … (more)
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with intellectual disability 41 (MIM#615637). (I) 0106 - This gene is associated with autosomal recessive disease. (I) 0216 - In-frame insertion in a non-repetitive region that has low conservation. (SP) 0251 - This variant is heterozygous. (I) 0304 - Variant is present in gnomAD <0.01 for a recessive condition (v2: 135 heterozygotes, 0 homozygotes). (SP) 0604 - Variant is not located in an established domain, motif, hotspot or informative constraint region. (I) 0705 - No comparable in frame duplication variants have previous evidence for pathogenicity. (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. It has been reported in at least six compound heterozygous probands with a neurodevelopmental disorder, including multiple affecteds in a large Amish family. In addition, it has been consistently classified as pathogenic by diagnostic laboratories in ClinVar (PMID:24239382, 32358097). (SP) 1002 - This variant has moderate functional evidence supporting abnormal protein function. In vitro assays have demonstrated protein mislocalization (PMID: 24239382). (SP) 1205 - This variant has been shown to be maternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
|
|
Pathogenic
(Oct 01, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV001334672.25
First in ClinVar: Jun 08, 2020 Last updated: Oct 20, 2024 |
Number of individuals with the variant: 5
|
|
Pathogenic
(Jan 02, 2014)
|
no assertion criteria provided
Method: literature only
|
INTELLECTUAL DEVELOPMENTAL DISORDER, AUTOSOMAL RECESSIVE 41
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000119894.7
First in ClinVar: Feb 26, 2014 Last updated: Jun 02, 2024 |
Comment on evidence:
For discussion of the 18-bp in-frame duplication in exon 8 of the KPTN gene (c.714_731dup) that was found in compound heterozygous state in patients with … (more)
For discussion of the 18-bp in-frame duplication in exon 8 of the KPTN gene (c.714_731dup) that was found in compound heterozygous state in patients with autosomal recessive intellectual developmental disorder-41 (MRT41; 615637) by Baple et al. (2014), see 615620.0001. In a 9-year-old boy with MRT41, Thiffault et al. (2020) identified compound heterozygous mutations in the KPTN gene, c.714_731dup (c.714_731dup, NM_007059.2) and a c.394+1G-A transition (615620.0004) in intron 3, predicted to result in a splicing abnormality. The mutations were identified by whole-genome sequencing and confirmed by Sanger sequencing. The mother was shown to be a carrier of the splice site variant but not the duplication, indicating that the variants were in trans. The c.714_731dup variant was present in the gnomAD database at an allele frequency of 0.05%, and the c.394+1G-A variant was present in the gnomAD database at an allele frequency of 0.007%. Functional studies were not performed. (less)
|
|
Pathogenic
(Jul 16, 2024)
|
no assertion criteria provided
Method: clinical testing
|
KPTN-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004114398.2
First in ClinVar: Nov 20, 2023 Last updated: Oct 08, 2024 |
Comment:
The KPTN c.714_731dup18 variant is predicted to result in an in-frame duplication (p.Met241_Gln246dup). This variant has been reported in the compound heterozygous state with a … (more)
The KPTN c.714_731dup18 variant is predicted to result in an in-frame duplication (p.Met241_Gln246dup). This variant has been reported in the compound heterozygous state with a loss of function variant in KPTN (c.776C>A, p.Ser259*) in individuals with global developmental delay, macrocephaly with frontal bossing, high levels of anxiety, and features suggestive of a pervasive developmental disorder (Baple et al. 2014. PubMed ID: 24239382). This variant was also reported along with a splicing variant in KPTN (c.394+1G>A) in an individual with macrocephaly, intractable epilepsy, atrial septal defect, global developmental delay, hypotonia, hypoglycemia, and dysmorphia (Phase not reported, Thiffault et al. 2018. PubMed ID: 30008475). This variant is reported in 0.10% of alleles in individuals of European (Finnish) descent in gnomAD. This variant is interpreted as pathogenic. (less)
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Pathogenic variants in KPTN gene identified by clinical whole-genome sequencing. | Thiffault I | Cold Spring Harbor molecular case studies | 2020 | PMID: 32358097 |
Clinical genome sequencing in an unbiased pediatric cohort. | Thiffault I | Genetics in medicine : official journal of the American College of Medical Genetics | 2019 | PMID: 30008475 |
Mutations in KPTN cause macrocephaly, neurodevelopmental delay, and seizures. | Baple EL | American journal of human genetics | 2014 | PMID: 24239382 |
Text-mined citations for rs587777148 ...
HelpRecord last updated Nov 19, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.