VCV000099841.16 - ClinVar

NM_001378477.3(NYX):c.70_93del (p.Arg24_Ala31del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(8)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001378477.3(NYX):c.70_93del (p.Arg24_Ala31del)

Variation ID: 99841 Accession: VCV000099841.16

Type and length

Deletion, 24 bp

Location

Cytogenetic: Xp11.4 X: 41473529-41473552 (GRCh38) [ NCBI UCSC ] X: 41332782-41332805 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2013	Sep 29, 2024	May 8, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_001378477.3:c.70_93del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001365406.2:p.Arg24_Ala31del	inframe deletion
NM_001378477.1:c.85_108del
NM_022567.3:c.70_93del	NP_072089.2:p.Arg24_Ala31del	inframe deletion
NC_000023.11:g.41473538_41473561del
NC_000023.10:g.41332791_41332814del
NG_009112.1:g.31079_31102del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000023.11:41473528:GCCTGCGCCCGCGCTTGTCCCGCCGCCTGCGCC:GCCTGCGCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA227954 OMIM: 300278.0001 dbSNP: rs281865194 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
NYX		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	391	544

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (5)	criteria provided, multiple submitters, no conflicts	Jan 3, 2024	RCV000086275.15
Congenital stationary night blindness 1A	Pathogenic (2)	criteria provided, single submitter	May 8, 2024	RCV001847656.2
Retinal dystrophy	Pathogenic (1)	criteria provided, single submitter	Jul 19, 2019	RCV001073621.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Jul 21, 2015)	criteria provided, single submitter (EGL Classification Definitions 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Eurofins Ntd Llc (ga) Accession: SCV000332913.4 First in ClinVar: Dec 06, 2016 Last updated: Dec 15, 2018	Publications: PubMed (2) PubMed: 11062471‚ 19578023 Other databases http://www.egl-eurofins.com/emvc… http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=NYX Number of individuals with the variant: 1 Sex: mixed
Pathogenic (Mar 20, 2023)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001982783.3 First in ClinVar: Oct 30, 2021 Last updated: Sep 29, 2024	Comment: In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with … (more) In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 18617546, 11062471, 19578023) (less)
Pathogenic (Jul 19, 2019)	criteria provided, single submitter (Blueprint Genetics Variant Classification Scheme) Method: clinical testing	Retinal dystrophy Affected status: yes Allele origin: germline	Blueprint Genetics Accession: SCV001239172.1 First in ClinVar: Apr 18, 2020 Last updated: Apr 18, 2020 Comment: My Retina Tracker patient
Pathogenic (Jan 03, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001211381.5 First in ClinVar: Apr 15, 2020 Last updated: Feb 20, 2024	Publications: PubMed (2) PubMed: 11062471‚ 19578023 Comment: This variant, c.85_108del, results in the deletion of 8 amino acid(s) of the NYX protein (p.Arg29_Ala36del), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.85_108del, results in the deletion of 8 amino acid(s) of the NYX protein (p.Arg29_Ala36del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs281865194, gnomAD 0.01%). This variant has been observed in individuals with congenital stationary night blindness (PMID: 11062471, 19578023). It has also been observed to segregate with disease in related individuals. This variant is also known as 85‚Äì108del24nt (RACPAACA29-36del). ClinVar contains an entry for this variant (Variation ID: 99841). For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Oct 23, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided (X-linked recessive inheritance) Affected status: yes Allele origin: germline	Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen Accession: SCV001447295.1 First in ClinVar: Nov 28, 2020 Last updated: Nov 28, 2020	Clinical Features: Congenital stationary night blindness (present) Sex: male
Pathogenic (May 08, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Congenital stationary night blindness 1A Affected status: yes Allele origin: germline	Clinical Genomics Laboratory, Washington University in St. Louis Accession: SCV005045142.1 First in ClinVar: May 26, 2024 Last updated: May 26, 2024	Comment: The NYX c.85_108del (p.Arg29_Ala36del) variant has been reported in 29 individuals in eight families with X-linked complete congenital stationary night blindness (Bech-Hansen NT et al., … (more) The NYX c.85_108del (p.Arg29_Ala36del) variant has been reported in 29 individuals in eight families with X-linked complete congenital stationary night blindness (Bech-Hansen NT et al., PMID: 11062471; Zeitz C et al., PMID: 19578023). A genotype analysis of the X chromosomes with this deletion suggest that this is a common founder mutation. This variant is only observed on 1/19,558 alleles in the general population (gnomAD v.2.1.1), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame deletion of eight amino acids in a non-repeat region. This variant has been reported in the ClinVar database as a germline pathogenic variant by six submitters. Based on available information and the ACMG/AMP guidelines for variant interpretation (Richards S et al., PMID: 25741868), this variant is classified as pathogenic. (less)
Pathogenic (Nov 01, 2000)	no assertion criteria provided Method: literature only	NIGHT BLINDNESS, CONGENITAL STATIONARY, TYPE 1A Affected status: not provided Allele origin: germline	OMIM Accession: SCV000032407.1 First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013	Publications: PubMed (1) PubMed: 11062471 Comment on evidence: In 7 families from the United States, Bech-Hansen et al. (2000) found that the same in-phase 24-bp deletion was associated with X-linked complete congenital stationary … (more) In 7 families from the United States, Bech-Hansen et al. (2000) found that the same in-phase 24-bp deletion was associated with X-linked complete congenital stationary night blindness (310500). The deletion was predicted to result in the loss of the 8 amino acids RACPAACA from the N-terminal cysteine cluster of nyctalopin. A genotype analysis of the X chromosomes with this deletion suggested that these families share a common founder mutation. (less)
not provided (-)	no classification provided Method: not provided	not provided Affected status: not provided Allele origin: not provided	Retina International Accession: SCV000118421.1 First in ClinVar: Feb 20, 2014 Last updated: Feb 20, 2014 Comment: http://phencode.bx.psu.edu/cgi-bin/phencode/phencode?build=hg19&id=RISN_NYX:c.85_108del

Comment:

This variant, c.85_108del, results in the deletion of 8 amino acid(s) of the NYX protein (p.Arg29_Ala36del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs281865194, gnomAD 0.01%). This variant has been observed in individuals with congenital stationary night blindness (PMID: 11062471, 19578023). It has also been observed to segregate with disease in related individuals. This variant is also known as 85‚Äì108del24nt (RACPAACA29-36del). ClinVar contains an entry for this variant (Variation ID: 99841). For these reasons, this variant has been classified as Pathogenic.

Comment:

The NYX c.85_108del (p.Arg29_Ala36del) variant has been reported in 29 individuals in eight families with X-linked complete congenital stationary night blindness (Bech-Hansen NT et al., PMID: 11062471; Zeitz C et al., PMID: 19578023). A genotype analysis of the X chromosomes with this deletion suggest that this is a common founder mutation. This variant is only observed on 1/19,558 alleles in the general population (gnomAD v.2.1.1), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame deletion of eight amino acids in a non-repeat region. This variant has been reported in the ClinVar database as a germline pathogenic variant by six submitters. Based on available information and the ACMG/AMP guidelines for variant interpretation (Richards S et al., PMID: 25741868), this variant is classified as pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Genotyping microarray for CSNB-associated genes.	Zeitz C	Investigative ophthalmology & visual science	2009	PMID: 19578023
Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness.	Bech-Hansen NT	Nature genetics	2000	PMID: 11062471
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=NYX	-	-	-	-

Text-mined citations for rs281865194 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_001378477.3(NYX):c.70_93del (p.Arg24_Ala31del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs281865194 ...