Common allele nameAlternative namesHGVS reference sequencedbSNP reference identifier for allele location
CodingProtein
rs3918290DPYD*2A, c.1905+1G>A NM_000110​.3:c.1905+1G>A Not applicable—deletion of exon 14 leads to the production of a truncated protein rs3918290 
IVS14+1G>A
rs55886062DPYD*13, c.1679T>G, rs55886062.1, p.Ile560Ser NM_000110​.3:c.1679T>G NP_000101​.2:p.Ile560Ser rs55886062
rs67376798c.2846A>T
p.Asp949Val		 NM_000110​.3:c.2846A>T NP_000101​.2:p.Asp949Val rs67376798
rs75017182c.1129–5923C>G NM_000110​.3:c.1129-5923C>G Altered mRNA splicing introduces premature termination codon in resulting protein. rs75017182
rs1801159DPYD*5, c.1627G>A NM_000110​.4:c.1627A>G NP_000101​.2:p.Ile543Val rs1801159
rs1801265DPYD*9A, c.85T>C NM_000110​.4:c.85T>C NP_000101​.2:p.Cys29Arg rs1801265
rs1801158DPYD*4, c.1601G>A NM_000110​.4:c.1601G>A NP_000101​.2:p.Ser534Asn rs1801158
rs1801160DPYD*6, c.2194G>A NM_000110​.4:c.2194G>A NP_000101​.2:p.Val732Ile rs1801160
rs72549306DPYD*11, c.1003G>T, rs72549306.1NM_000110.4:c.1003G>TNP_000101.2:p.Val335Leu rs72549306
rs1801267DPYD*9B, c.2657G>A NM_000110​.4:c.2657G>A NP_000101​.2:p.Arg886His rs1801267
rs72549303DPYD*3, c.1898delC NM_000110​.4:c.1898del NP_000101​.2:p.Pro633fs rs72549303
rs72549309DPYD*7, c.295_298delTCAT NM_000110​.4:c.295_298TCAT[1] NP_000101​.2:p.Phe100fs rs72549309
rs1801266DPYD*8, c.703C>T NM_000110​.4:c.703C>T NP_000101​.2:p.Arg235Trp rs1801266
rs1801268DPYD*10, c.2983G>T NM_000110​.4:c.2983G>T NP_000101​.2:p.Val995Phe rs1801268
rs78060119DPYD*12, c.1156G>TNM_000110.4:c.1156G>TNP_000101.2:p.Glu386Ter rs78060119
rs115232898557A>G (Y186C) NM_000110​.4:c.557A>G NP_000101​.2:p.Tyr186Cys rs115232898
rs2297595496A>G (M166V) NM_000110​.4:c.496A>G NP_000101​.2:p.Met166Val rs2297595
rs75017182
rs56038477		HapB3
1129-5923C>G
1236G>A		 NM_000110​.4:c.1129-5923C>G
NM_000110​.4:c.1236G>A 		Altered mRNA splicing introduces premature termination codon in resulting protein.
NP_000101.2:p.Glu412=		 rs75017182
rs56038477

rs45445694		2R, 3R TYMS 5’UTRGRCh37.p13 chr 18, NC_000018.9:g.657657_657712del,
NC_000018.9:g.657657_657684GGCCTGCCTCCGTCCCGCCGCGCCACTT[1]-[9]#		 rs45445694
rs11280056TYMS 3’UTRGRCh37.p13 chr 18, NC_000018.9:g.673447_673452del, NC_000018.9:g.673447_673452dup#
NM_017512​.7:c.*856_*861del		 rs11280056
rs2853542TYMS 3RG, 3RCGRCh37.p13 chr 18, NC_000018.9:g.657685G>C#
NM_001071.4:c.-58=		 rs2853542
#

This is a non-coding variant in the TYMS untranslated region. Coordinates given are chromosomal.

Pharmacogenetic Allele Nomenclature: International Workgroup Recommendations for Test Result Reporting (68).

Allele information for DPYD can also be found at the Pharmacogene Variation Consortium (PharmVar).

Guidelines for the description and nomenclature of gene variations are available from the Human Genome Variation Society (HGVS).

From: Capecitabine Therapy and DPYD Genotype

Cover of Medical Genetics Summaries
Medical Genetics Summaries [Internet].
Pratt VM, Scott SA, Pirmohamed M, et al., editors.
Copyright Notice

All Medical Genetics Summaries content, except where otherwise noted, is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license which permits copying, distribution, and adaptation of the work, provided the original work is properly cited and any changes from the original work are properly indicated. Any altered, transformed, or adapted form of the work may only be distributed under the same or similar license to this one.

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.