BioSample

The mRNA was isolated from roots of Glycine max 'Supernod' plants generously donated by Dr. Gary Stacey. The seedlings were innoculated with Bradyrhizobium japonicus, strain USDA110 priot to harvest. Stratagene's cDNA synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An 'anchor' nucleotide (V=A,C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA polymerase, ligated to EcoRI adapters and subsequently phosphorylated. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript II XR Predigested vector (pBluescript II SK(+) that has been digested with EcoRI and XhoI, and phosporylated by Stratagene). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=25). This library was constructed by Dr. Paul Keim and Dr. Virginia Coryell.