Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_281) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on