Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.3 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_222) and was constructed by Express Genomics (Frederick, MD).
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on